Effect of Anacardic Acid against Thiram Induced Tibial Dyschondroplasia in Chickens via Regulation of Wnt4 Expression

Transcription

1 animals Article Effect of Anacardic Acid against Thiram Induced Tibial Dyschondroplasia in Chickens via Regulation of Wnt4 Expression Xiong Jiang 1,2, Hui Zhang 1, Khalid Mehmood 1,3, Kun Li 1, Lihong Zhang 1, Wangyuan Yao 1, Xiaole Tong 1, Aoyun Li 1, Yaping Wang 1, Jinhuan Jiang 1, Mujahid Iqbal 1,4, Muhammad Waqas 1 Jiakui Li 1,2, * 1 College of Veterinary Medicine, Huazhong Agricultural University, Wuhan , China; jiangxiongtgc@sina.com (X.J.); dahuilang@webmail.hzau.edu.cn (H.Z.); khalid.mehmood@webmail.hzau.edu.cn (K.M.); likun2008@webmail.hzau.edu.cn (K.L.); zhanglihong@webmail.hzau.edu.cn (L.Z.); yaowangyuan@webmail.hzau.edu.cn (W.Y.); tongxl@webmail.hzau.edu.cn (X.T.); aoyunli@sina.cn (A.L.); @163.com (Y.W.); jinhuan1107j@163.com (J.J.); mujahid@cuvas.edu.pk (M.I.); muhammadwaqas@upr.edu.pk (M.W.) 2 College of Animals Husbry Veterinary Medicine, Tibet Agricultural Animal Husbry University, Linzhi, Tibet , China 3 University College of Veterinary & Animal Sciences, Islamia University of Bahawalpur, Bahawalpur 63100, Pakistan 4 Department of Pathology, Cholistan University of Veterinary Animal Sciences (CUVAS), Bahawalpur 63100, Pakistan * Correspondence: lijk210@sina.com; Tel.: Received: 23 January 2019; Accepted: 28 February 2019; Published: 6 March 2019 Simple Summary: This study evaluated ameliorating effect of anacardic acid (AA) in tibial dyschondroplasia (TD) chickens. Our results that AA can increase feed conversion ratio, improve weight, length of tibia. AA administration restored antioxidant parameters significantly (p < 0.05). The gene expression analysis revealed a decrease in wingless-type member 4 (Wnt4) expressions in TD chickens as compared to control group, while AA treatment up-regulated Wnt4 expression. The present study demonstrates that AA plays an important role to prevent lameness restore size of tibial growth plate of chickens by regulating expression of Wnt4. Abstract: Tibial dyschondroplasia (TD) is a tibia bone problem in broilers. Anacardic acid (AA) is a traditional Chinese medicine, which is commonly used to treat arthritis in human. The purpose of present study is to investigate effect of AA against TD. A total of 300 day-old poultry birds were equally divided distributed into three different groups: Control, TD AA groups. The results that feed conversion ratio significantly lower in TD group than control chickens. The tibia bone parameters including weight, length were of low quality in TD chickens, while of tibial growth plate enlarged remarkably. Whereas, in AA treatment group, tibia bone parameters improvement tend to return to normal. The antioxidant parameters level of glutathione peroxidase (GSH-Px), superoxide dismutase (SOD), total antioxidant capacity (T-AOC) significantly decreased, while malondialdehyde (MDA) level increased significantly in TD affected chickens. AA administration restored antioxidant parameters significantly. The gene expression revealed a decrease in Wnt4 expression in TD chickens as compared to control chickens, while AA treatment up-regulated Wnt4 expression. The present study demonstrates that AA plays an important role to prevent lameness restore size of tibial growth plate of chickens by regulating expression of Wnt4. Animals 2019, 9, 82; doi: /ani

2 Animals 2019, 9, 82 2 of 10 Keywords: Wnt4; anacardic acid; growth plate; chickens; tibial dyschondroplasia 1. Introduction Tibial dyschondroplasia is a major poultry leg problem in rapidly growing birds, especially chickens around world, in which growth plate (GP) cartilage presents excessive amount in metaphyseal of tibia [1 3]. This dull white GP is characterized by reduced endochondral ossification, tibial metaphyseal cartilage cell proliferation, a vascular non-mineralized cartilage wedge, which ultimately leads to overt locomotion problems [4,5]. In 1978, this disease first described in turkeys a recent statistical study revealed that almost 30% of bone disease Tibial dyschondroplasia (TD) in chickens turkeys with high morbidity, mortality condemnation at processing plant, which is responsible for huge economic losses to poultry industry [4,5]. Moreover, lameness which is commonly related to TD is also a serious animal welfare issue in broiler chickens. Many studies have been reported that it is caused by a disturbance in vascular development, osteoblast formation genes related to bone vascularization mineralization [3,6]. Wingless-type member 4 (Wnt4), helps in cell proliferation, differentiation in humans or species [7]. Wnt4 is a secreted protein from osteoblasts has a significant effect to inhibit bone resorption [8]. Traditional Chinese herbal medicines have been proven to be effective for treatment of various diseases conditions in both humans animals. History goes back to thouss of years of practice with safe wide sources. Along with or benefits, matory action makes such drugs as a first choice in drug screening [9]. Anacardic acid (AA) is a Chinese traditional medicine, which is purified from bark of Amphiptery giumadstringens. Recent research that AA could inhibit proliferation of different kinds of tumor cells (lung, liver prostate cancer). It is also capable of inducing apoptosis [10]. Moreover, some researchers found that sumac acid has played a good role against bone arthritis in mice through regulation of matrix metalloproteinases (MMPs) expression for treatment of osteoarthritis. Wnt4 is an important secreted protein; secreted more from osteoblasts confirmed a protective effect against chronic inflammation bone loss. Considering characteristics of AA, we hyposized that AA could better treat TD via improving Wnt4 expression. Therefore, main objective of this study is to check rapeutic effect of AA on TD affected chickens to explore its molecular mechanisms. 2. Materials Methods 2.1. Ethical Approval All animal experiments were carried out according to guidelines of Animal Care, Health Supervisory Committee of Huazhong Agricultural University, China (approval no ) Chickens Husbry Three hundred day-old Arbor Acres chickens (weighing 49 ± 7 g) were brought from a market raised under stard temperature humidity conditions. All chickens were fed stard ad libitumdiet according to guideline of National Research Council (1994). After 3 days, chicks were romly distributed between control group (n = 100) with a stard diet, thiram group (n = 200). Thiram group offered a stard diet with addition of thiram (50 mg/kg ofdiet). On day 7, one hundred birds from thiram group were separated named as AA group, which fed on stard feed along with mg/kg/day until end of experiment.

3 Animals 2019, 9, 82 3 of Morphological, Production Parameters Analysis Sample Collection All groups were reared for 18 days, while data regarding number of lame birds in each group recorded on daily basis. Twenty chickens from each group were romly selected slaughtered on days 7, 10, After euthanizing, tibia bones were measured for morphological examination including weight, length, of tibial bone size of tibial GP by an electronic balance Digital Calipers respectively. The TD score calculated in all groups according to Pines et al. [11]. From each group, liver, blood tibia bones collected immediately stored at 70 C for furr analysis Hematoxylin Eosin (H E) Staining The tibia bone samples were decalcified in Ethylene diaminetetraacetic acid (EDTA) fluid (10%), dehydrated alcohol solutions, cleaned in xylene fixed in paraffin wax. The sections were sliced to prepare slides. In end, histological sections were stained with H E to observe pathological changes under light microscope according to a previous study [12]. The Image-Pro Plus 6.0 (Media Cybernetics, Georgia, USA) used to analyze blood vessel area Measurement of SOD, MDA Contents, GSH-Px, T-AOC Activity The analysis of superoxide dismutase (SOD), malondialdehyde (MDA) contents, glutathioneperoxidase (GSH-Px), total antioxidant capacity (T-AOC) performed using commercial assay kit (Nanjing Institute of Biological Engineering Inc. Jiangsu, China) as mentioned in a previous study [13]. Briefly, liver samples in each group were rinsed, measured n homogenized for 10 min. After that, centrifugation 3000 rpm for 10 min at 4 C Reverse Transcription Quantitative-Polymerase Chain Reaction (RT-qPCR) Total RNA of primary tibial growth plates extracted using TRIzol (Google biological, Wuhan, China), n converted into cdna by using a cdna kit (Tian Gen, China) as per manufacturer s recommendations. The primers for Wnt4 gene were designed with Primer Premier Software (version 5.0, Premier, Canada) as F, AGCTCTTAGACTGGCTTGTGT; R, TGCTCGGGTCAGTCAAACTC. The RT-qPCR run in quadruplex by using specific primers with cycling protocol of Shahzad et al. [6]. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) used as a control housekeeping gene Western Blot Analysis The growth plate of individual tissues homogenized kept at 4 C for 2 h n centrifuged. After that, concentrations of total proteins were determined according to our previous study Zhang et al. [14] Statistical Analysis The differences means among various groups were compared through Analysis of variance (NOVA) student t-test to compare by using SPSS 19.0 software (SPSS Version Chicago, IL, USA). The data are presented as means ± S.E.M (stard error of means). 3. Results 3.1. Effects of AA on Lameness, Growth-Plate Morphology The visual examination of chickens depression, weakness, lameness, feeding difficulties poor body condition in TD chickens. While, after AA medicine treatment, chickens started to walk properly with no lameness. The size of tibial growth plate (GP) markedly increased in

4 Animals 2019, 9, 82 Animals 2019, 9, x Animals 2019, 9, x 4 of 10 4 of 10 4 of 10 thiram group compared with control group. The AA medicine administration significantly markedly increased in thiram group compared with control group. The AA medicine reduced sizeincreased of GP compared with group markedly in thiram group compared with 1). control group. AA 1). medicine administration significantly reduced TD size of GP (Figure compared with TD groupthe (Figure administration significantly reduced size of GP compared with TD group (Figure 1). effects of AA on TD dependentlameness lameness tibia articular cartilage, BV =BV Figure Figure 1. The1.The effects of AA on TD dependent tibiabone. bone.ac= AC= articular cartilage, Figure 1.The effects AA on TD dependent lesion, lameness tibia bone. blood vessel, TDL =oftibial dyscondroplasia GP = growth plate.ac= AAarticular = Anacardic acid, BV TD=acid, = = blood vessel, TDL = tibial dyschondroplasia lesion, GP = growth plate. AA =cartilage, Anacardic blood TDL = tibial dyscondroplasia lesion, GP = growth plate. AA = Anacardic acid, TD = tibial vessel, dyscondroplasia TD = tibial dyschondroplasia. tibial dyscondroplasia TD Score 3.2. TD3.2. Score 3.2. TD Score The results that thiram can induce TD; almost 90% of chickens were found lame after The results that thiram can induce TD; almost 90% of chickens were found lame after that thiram cancontrol induce group, TD; almost chickens were found lame day The 4 ofresults thiram administration. In tibia 90% had of almost normal phenotype after less day 4 day of thiram administration. In control group, tibia had almost almostnormal normal phenotype less 4 of thiram administration. control group, tibia had phenotype average TD score. However, AAIngroup that chicken restored TD pathogenesis afterless average TD score. However, AA group that chicken restored TD pathogenesis after average TD score. AA group that chicken TD pathogenesis after of administration of However, AA more than 30% of chickens wererestored found healthy more than 60% administration of AA TD more than 30% foundhealthy healthy more than administration of AA more than 30%of ofchickens chickens were found more than 60%60% of of chickens less (score 1) on day 18 (Figure 2).were chickens less TD 1) on day 1818 (Figure chickens less (score TD (score 1) on day (Figure2). 2). Figure 2. Effect of thiram AA on TD scores in chickens. TD severity score on day 7, 10, Figure 2. Effect of thiram AA on TD scores in chickens. TD severity score on day 7, 10, Figure 2. Effect thiram AA onaa TDgave scores in chickens. TD severity score on dayon 7, day 10, 14 Compared withof TD group, significant decreased in TD, especially Compared with with TD group, AA gave significant intd, TD,especially especially 14 Compared TDTD group, AA gave significantdecreased decreased in on on dayday AA = Anacardic acid, = tibial dyscondroplasia AA = Anacardic acid,acid, TD =TD tibial dyschondroplasia. AA = Anacardic = tibial dyscondroplasia 3.3. Tibial Parameters Evaluation 3.3. Tibial Parameters Evaluation 3.3. Tibial Parameters Evaluation The tibial parameters like tibial length,, weight of GP in chickens were The tibial like tibial length, weight of GPofinGP chickens were recorded The parameters tibial parameters like on tibial weight performance in chickens were recorded among all groups dayslength, 7,, 10, 14, 18. An overall parameters analysis amongrecorded all groups on days 7, 10, An overall performance parameters analysis of tibia among all that groups days 7, 10, 14trend 18. An overall parameters analysis of tibia bone reon a positive among lengthperformance of tibia, weight of tibia offrom tibiaday bone that a trend positive trend length of tibia, weight of tibia bone that re are positive among length of tibia, weight of GP tibia from 7 to day 18, but difference notamong significant. Meanwhile, of to day 18, but difference not significant. Meanwhile, ofsignificantly GP day 7 from to dayday 18,7but difference not significant. Meanwhile, of GP enlarged (p < 0.05) in TD group than control group. However, with administration of AA, GP decreased significantly in AA group compared with TD group (Figure 3).

5 Animals 2019, 9, x 5 of 10 significantly enlarged (p < 0.05) in TD group than control group. However, with Animals administration 2019, 9, 82 of AA, GP decreased significantly in AA group compared with TD 5 of 10 group (Figure 3). Figure Figure 3. Effects 3. Effects of AAof onaa thiram-induced on thiram-induced tibial dyschondroplasia tibial chickens chickens via overall via overall tibial parameters tibial analysis. parameters (A D) analysis. correlation (A D) correlation analysis among analysis among length, length,,, weight weight of of tibia size size of tibial of growth tibial growth plate plate were were analyzed analyzed using using Pearsontest. test. C = C control; = control; AA = AA Anacardic = Anacardic acid, TD acid, = tibial dyscondroplasia TD = tibial dyschondroplasia Histological 3.4. Histological Examination of Tibial of Tibial Growth Plate Tibial Tibial growth growth plates plates were were evaluated with hematoxylin eosin eosin (H (H E) E) re rea prominent difference between TD control group. The columns were well-conserved a prominent difference between TD control group. The columns were well-conserved surrounded with a large number of blood vessels in hypertrophic proliferative zone of GP in surrounded with a large number of blood vessels in hypertrophic proliferative zone of control group. In TD affected birds, histological examination that GP revealed GP in necrosis control few group. blood In vessels TD affected with immature birds, cartilage histological cells examination cells were arranged that tightly. GP revealed Whereas necrosis administration few blood of AA vessels medicine with resulted immature in new cartilage blood vessels cells formation, cells were arranged of tightly. Whereas hypertrophic administration region reversed of AA medicine angiogenesis resulted in new observed blood significantly vessels formation, (Figure 4A). The blood of hypertrophic vision analysis region indicated reversed that re angiogenesis a significant difference observed between significantly TD (Figure AA group 4A). during The blood vision analysis entire study indicated period that on various re days a significant (Figure 4B). difference between TD AA group during entire study period on various days (Figure 4B). Animals 2019, 9, x 6 of 10 Figure Figure 4. The 4. HThe H E analysis E analysis of normal of normal GP GP indicates indicates regular regular columns cells cells surrounded by by many bloodmany vessels. blood (A) vessels. H (A) E analysis. H E analysis. (B) Trabecular (B) Trabecular bone volume bone volume assay assay of different of different groups. groups. Growth plates Growth in plates TD group in were TD group less were vascularized less vascularized AA restored AA restored angiogenesis. * p *p < < 0.05; ** p < AA = Anacardic AA = Anacardic acid, TD acid, = tibial TD = dyschondroplasia. tibial dyscondroplasia 3.5. Liver Antioxidant Levels Our results indicated that compared to control group, level of SOD, T-AOC GSH-Px were significantly less (p < 0.05) in TD group. Whereas, level of MDA enhanced in TD group as compared to control group chickens. However, AA treatment reversed se variations,

6 Animals 2019, 9, 82 6 of Liver Antioxidant Levels Animals Our2019, results 9, x indicated that compared to control group, level of SOD, T-AOC 7 GSH-Px of 10 were significantly less (p < 0.05) in TD group. Whereas, level of MDA enhanced in TD group as compared to control group chickens. However, AA treatment reversed se variations, SOD, T-AOC GSH-Px level increased MDA level decreased significantly (p < 0.05) as shown in Figure 5. Animals 2019, 9, x 7 of 10 Figure Figure Effect 5. of Effect AA of on AA liver on liver antioxidant activities in broilers in broilers at at 7, 7, 10, at 10, 147, 1410, 18d.The 1418d.The data 18d.The are data are data areshown as shown as mean± as mean mean± SEM. ± SEM. (a) T-AOC. (a) (a) T-AOC. (b) (b) SOD. (b) SOD. (c) GSH-Px (c) GSH-Px (d) MDA. (d) AA MDA. AA = Anacardic = Anacardic AA = acid, Anacardic TD acid, = TD acid, = tibial dyscondroplasia TD tibial = tibial dyscondroplasia dyschondroplasia Effects of AA Expression of Wnt4 Gene in Effects Effects of of AA AA on on Expression of of Wnt4 Gene in Growth Plate RT-qPCR western blot were employed to investigate expressions of Wnt4 mrna levels RT-qPCR in growth western plate. blot blot The overall were employed expression to to levels investigate of Wnt4 were expressions decreased significantly of Wnt4 mrna in TD levels in in growth growth affected plate. plate. chickens The overall The as overall compared expression expression to levels control levels ofgroup. Wnt4 While Wnt4 were decreased were mrna decreased level significantly of significantly that gene in TDin affected TD chickens affected asincreased chickens compared on as day to compared 10, 14 control 18 to after group. control administration Whilegroup. mrna of While AA (Figure level of mrna 6). that Furrmore, gene level of that increased western gene on day blot analysis results were also parallel to gene expression results (Figure 7). 10, increased 14 18on after day 10, administration after of AA administration (Figure 6). Furrmore, of AA (Figure 6). western Furrmore, blot analysis western results were blot also analysis parallel results to gene were expression also parallel results to gene (Figure expression 7). results (Figure 7). Figure 6. RT-qPCR analysis indicates expression of Wnt4 gene in control, thiram AA groups on various days. Data are presented as means ± SEM, * p < 0.05; ** p < AA = Anacardic acid, TD = tibial dyscondroplasia Figure Figure RT-qPCR analysis indicates expression of of Wnt4 genein in control, thiram thiram AA AA groups groups on on various days. Data are presented as as means ± SEM, ± SEM, * p < * 0.05; p < 0.05; ** p < ** p < AA = Anacardic AA = Anacardic acid, TD acid, = TD tibial = tibial dyscondroplasia dyschondroplasia.

7 Animals 2019, 9, 82 7 of 10 Animals 2019, 9, x 8 of 10 Figure Wnt4 protein expression levels were analyzed in tibial in tibial growth growth plate plate on various on various days in days in Control, Thiram AA groups. AA groups. Protein levels Protein of Wnt4 levels were of detected Wnt4 were by Western detected blot by analysis. Western Data blot analysis. are presented Data are as presented means as ± SEM; means * p < ± 0.05; SEM; ** p * p < < ; AA ** = p < Anacardic AA acid, = Anacardic TD = tibial acid, TD dyscondroplasia = tibial dyschondroplasia Discussion Tibial dyschondroplasia is mainly is mainly atibiotarsal atibiotarsal bone abnormality, bone abnormality, which iswhich common is in common fast-growing birds fast-growing especiallybirds in chicken especially in turkey chicken worldwide turkey [15]. worldwide It is characterized [15]. It is characterized by endochondral by ossification, endochondral a mass ossification, of avascular a mass opaque of avascular whiteopaque cartilage white wedge cartilage in metaphysical wedge in metaphysical part of tibiotarsus part of tibiotarsus tarsometatarsus tarsometatarsus bones [16,17]. The bones mechanism [16,17]. The beingmechanism responsiblebeing for responsible development for treatment development of se lesions treatment is still unclear of se [5]. lesions We checked is still unclear pathological [5]. We changes checked in pathological tibial growth plate changes by histological in tibial assessments. growth plate According by histological our assessments. results, GPAccording has a circular to our arc results, of cartilage GP has with a uniform circular thickness arc of cartilage smooth with uniform edges inthickness normal broilers; smooth while edges in growth normal plate broilers; cartilage while non-vascular, growth plate non-mineralized cartilage white non-vascular, cartilaginous non-mineralized mass in TD affected white cartilaginous chickens. This mass makes in it TD very easy affected for visual chickens. examination. This makes This it very cartilaginous easy for visual mass examination. ultimately This results cartilaginous in movement mass problem ultimately results in movement problem obstacles in sting. obstacles in sting. Wnts are important for mesenchymal precursor cells [18,19]. Adipogenesis disturbs Wnts are important for mesenchymal precursor cells [18,19]. Adipogenesis disturbs normal normal process of osteogenesis [20]. Wnt4 helps in cell proliferation, differentiation in human process of osteogenesis [20]. Wnt4 helps in cell proliferation, differentiation in human or or species [7], it protects bone from resorption stops osteoclast formation [21,22]. species [7], it protects bone from resorption stops osteoclast formation [21,22]. Wnt4 Wnt4 also reported to associate with femoral neck BMD lumbar spine in previous studies also [23,24]. reported The present to associate study with also investigates femoral neck causality BMD between lumbar common spine in previous rare genetic studies variations [23,24]. The inwnt4 present in study TD affected also investigates chickens. causality In our study, between we common found that rarewnt4 genetic level variations decreased inwnt4 in TDsignificantly affected chickens. in TD chickens In our as study, compared we found to that controlgroup Wnt4 level on day 7 to decreased day 14. However, significantly gene in TD chickens expression as compared levels were torestored controlgroup by AA day on day 18 compared 7 to day with 14. However, TD chickens. Our generesults expression indicated levels were that restored AA has a by protective AA on day effect 18over compared bone loss with TD bone chickens. resorption. Our results indicated that AA has a protective Thiram effect is over widely bone used loss in pesticide bonepractices resorption. in agriculture region, but it is also used to induce TD Thiram [14,23]. issome widelyreports used in pesticide that practices it interacts agriculture with GP region, disturb but it is alsometabolism used to induce TD [14, 23]. development Some reports of chondrocytes that itto interacts cause TD with [25 27]. GP On disturb or h, metabolism it reported that development thiram has of chondrocytes noxious effects to cause on liver TD [4,28 30], [25 27]. On which release or h, MDA itas isan reported end product that thiram during has lipid noxious peroxidation effects on liver [4,28 30], ultimately which result release in oxidative MDA as imbalance an end product [31,32]. Li during et al. lipid [33] reported peroxidation that thiram ultimately destroyed result in oxidative imbalance through [31,32]. decreasing Li et al. [33] SOD reported GSH-Px that thiram induced destroyed oxidative oxidative processes balance in chicken through decreasing liver such SOD as lipid peroxidation. GSH-Px induced Altoger, oxidative higher processes MDA concentrations in chicken liver affected such as lipid liver peroxidation. function Altoger, caused higher TD in MDA broilers. concentrations In this study, affected level of SOD, livert-aoc function GSH-Px caused were TDsignificantly in broilers. less In this study, (p < 0.05) level in of TD SOD, group T-AOC compared GSH-Px to control were significantly group. Whereas, less (p < 0.05) level in of MDA TD group increased compared in TD chickens as compared to normal chickens. On or h, with use of AA, level of to control group. Whereas, level of MDA increased in TD chickens as compared to normal antioxidants parameter significantly increased, while oxidative stress decreased chickens. On or h, with use of AA, level of antioxidants parameter significantly significantly (p < 0.05). increased, while oxidative stress decreased significantly (p < 0.05).

8 Animals 2019, 9, 82 8 of Conclusions The present study demonstrates that AA plays an important role in preventing lameness restoring size of tibial growth plate of chickens by regulating expression of Wnt4. Author Contributions: J.L., X.J., H.Z. designed study. X.J., H.Z., K.L., L.Z., M.I., W.Y., X.T., A.L., Y.W. J.J. arranged reagents performed experiments. X.J., H.Z., K.M. M.W. analyzed data manuscript writing. All authors have read approved final manuscript. Funding: The study supported by National Key Research Development Program of China (Project No. 2017YFD ), National Natural Science Foundation of China ( ). Acknowledgments: National Natural Science Foundation of China ( ). Conflicts of Interest: The authors declare no conflict of interest. References 1. Mehmood, K.; Zhang, H.; Iqbal, M.K.; Rehman, M.U.; Shahzad, M.; Li, K.; Huang, S.; Nabi, F.; Zhang, L.; Li, J. In Vitro effect of apigenin danshen in tibial dyschondroplasia through inhibition of heat-shock protein 90 vascular endolial growth factor expressions in avian growth plate cells. Avian Dis. 2017, 61, [CrossRef] [PubMed] 2. Mehmood, K.; Zhang, H.; Li, K.; Lei, W.; Rehman, M.U.; Nabi, F.; Iqbal, M.K.; Luo, H.; Shahzad, M.; Li, J. Effect of tetramethylpyrazine on tibial dyschondroplasia incidence, tibial angiogenesis, performance characteristics via HIF-1α/VEGF signaling pathway in chickens. Sci. Rep. 2018, 8, [CrossRef] [PubMed] 3. Nabi, F.; Li, K.; Shahzad, M.; Han, Z.; Zhang, D.; Liu, J.; Li, K. Gambogic acid inhibits hsp90 expressions in thiram-induced tibial dyschondroplasia. Pak. Vet. J. 2016, 36, Dan, H.; Simsa-Maziel, S.; Hisdai, A.; Sela-Donenfeld, D.; MonsonegoOrnan, E. Expression of matrix metalloproteinases during impairment recovery of avian growth plate. J. Anim. Sci. 2009, 87, [CrossRef] [PubMed] 5. Leach, R., Jr.; Monsonego-Ornan, E. Tibial dyschondroplasia 40 years later. Poult. Sci. 2007, 86, [CrossRef] [PubMed] 6. Shahzad, M.; Liu, J.; Gao, J.; Wang, Z.; Zhang, D.; Nabi, F.; Li, J.K. Differential expression of extracellular matrix metalloproteinase inducer (EMMPRIN/CD147) in avian tibial dyschondroplasia. Avian Pathol. 2015, 44, [CrossRef] [PubMed] 7. Timmermans-Sprang, E.P.M.; Gracanin, A.; Mol, J.A. Molecular Signaling of Progesterone, Growth Hormone, Wnt, HER in Mammary Gls of Dogs, Rodents, Humans, New Treatment Target Identification. Front. Vet. Sci. 2017, 4, [CrossRef] [PubMed] 8. Algaby, M.M.; Breikaa, R.M.; Eid, B.G.; Neamatallah, T.A.; Abdel-Naim, A.B.; Ashour, O.M. Icariin Protects against Thioacetamide-induced Liver Fibrosis in Rats, Implication of Anti-angiogenic Anti-autophagic Properties. Pharmacol. Rep. 2017, 69, [CrossRef] [PubMed] 9. Nambiar, J.; Bose, C.; Venugopal, M.; Banerji, A.; Patel, T.B.; Kumar, G.B.; Nair, B.G. AA inhibits gelatinases through regulation of Spry2, MMP-14, EMMPRIN RECK. Exp. Cell Res. 2016, 349, [CrossRef] [PubMed] 10. Seong, Y.A.; Shin, P.G.; Yoon, J.S.; Yadunam, A.K.; Kim, G.D. Induction of endoplasmic reticulum stress autophagy in human lung carcinoma A549 cells by AA. Cell Biochem. Biophys. 2014, 68, [CrossRef] [PubMed] 11. Pines, M.; Hasdai, A.; Monsonego-Ornan, E. Tibial dyschondroplasia tools, new insights future prospects. World s Poult. Sci. J. 2005, 61, [CrossRef] 12. Mehmood, K.; Zhang, H.; Iqbal, M.K.; Rehman, M.U.; Li, K.; Huang, S.; Shahzad, M.; Nabi, F.; Mujahid, I.; Li, J. Tetramethylpyrazine mitigates toxicity liver oxidative stress in tibial dyschondroplasia chickens. Pak. Vet. J. 2018, 38, [CrossRef] 13. Zhang, H.; Chang, Z.; Mehmood, K.; Rao, Z.A.; Nabi, F.; Rehman, M.U.; Wu, X.; Tian, X.; Yuan, X.; Li, Z.; et al. Nano copper induces apoptosis in pk-15 cells via a mitochondria-mediated pathway. Biol. Trace Elem. Res. 2018, 181, [CrossRef] [PubMed]

9 Animals 2019, 9, 82 9 of Zhang, H.; Khalid, M.; Jiang, X.; Yao, W.Y.; Mujahid, I.; Li, K. Effect of icariin on tibial dyschondroplasia incidence, tibial characteristics by regulating P2RX7 in chickens. Biomed. Res. Int. 2018, 2018, [CrossRef] [PubMed] 15. Simsa, S.; Hasdai, A.; Dan, H.; Ornan, E.M. Induction of tibial dyschondroplasia in turkeys by tetramethylthiuram disulfide (thiram). Poult. Sci. 2007, 86, [CrossRef] [PubMed] 16. Shim, M.Y.; Karnuah, A.B.; Anthony, N.B.; Pesti, G.M.; Aggrey, S.E. The effects of broiler chicken growth rate on valgus, varus, tibial dyschondroplasia. Poult. Sci. 2012, 91, [CrossRef] [PubMed] 17. Tian, W.X.; Zhang, W.P.; Li, J.K.; Bi, D.R.; Guo, D.Z.; Pan, S.Y.; Zhang, Y.H.; Qin, P. Identification of differentially expressed genes in growth plate of broiler chickens with thiram-induced tibial dyschondroplasia. Avian Pathol. 2009, 38, [CrossRef] [PubMed] 18. Aziz, A.; Miyake, T.; Engleka, K.A.; Epstein, J.A.; Mcdermott, J.C. Menin expression modulates mesenchymal cell commitment to myogenic osteogenic lineages. Dev. Biol. 2009, 332, 116. [CrossRef] [PubMed] 19. Zhu, X.; Zhu, H.; Zhang, L.; Huang, S.; Cao, J.; Ma, G.; Feng, G.; He, L.; Yang, Y.; Guo, X. Wls-mediated wnts differentially regulate distal limb patterning tissue morphogenesis. Dev. Biol. 2012, 365, [CrossRef] [PubMed] 20. Millet, L. Role of wnt pathway in determination of human mesenchymal stem cells into preadipocytes. J. Mol. Endocrinol. 2001, 46, R Yu, B.; Chang, J.; Liu, Y.; Li, J.; Kevork, K.; Al-Hezaimi, K.; Graves, D.T.; Park, N.H.; Wang, C.Y. Wnt4 signaling prevents skeletal aging inflammation by inhibiting nuclear factor-kappa B. Nat. Med. 2014, 20, [CrossRef] [PubMed] 22. Zhang, H.; Mehmood, K.; Li, K.; Rehman, M.U.; Jiang, X.; Huang, S.; Wang, L.; Zhang, L.; Tong, X.; Nabi, F.; et al. Icariin Ameliorate Thiram-Induced Tibial Dyschondroplasia via Regulation of WNT4 VEGF Expression in Broiler Chickens. Front. Pharmacol. 2018, 9, 123. [CrossRef] [PubMed] 23. Rasaputra, K.S.; Liyanage, R.; Lay, J.O.; McCarthy, F.M., Jr.; Rath, N.C. Tibial dyschondroplasia-associated proteomic changes in chicken growth plate cartilage. Avian Dis. 2010, 54, [CrossRef] [PubMed] 24. Zheng, Y.; Wang, C.; Zhang, H.; Shao, C.; Gao, L.H.; Li, S.S.; Yu, W.J.; He, J.W.; Fu, W.Z.; Hu, Y.Q.; et al. Polymorphisms in wnt signaling pathway genes are associated with peak bone mineral density, lean mass, fat mass in chinese male nuclear families. Osteoporos. Int. 2016, 27, [CrossRef] [PubMed] 25. Rath, N.C.; Huff, W.E.; Huff, G.R. Thiram-induced changes in expression of genes relating to vascularization tibial dyschondroplasia. Poult. Sci. 2007, 86, [CrossRef] [PubMed] 26. Mehmood, K.; Zhang, H.; Jiang, X.; Yao, W.; Tong, X.; Iqbal, M.K.; Rehman, M.U.; Iqbal, M.; Waqas, M.; Qamar, H.; et al. Ligustrazine recovers thiram-induced tibial dyschondroplasia in chickens, involvement of new molecules modulating integrin beta 3. Ecotoxicol. Environ. Saf. 2019, 168, [CrossRef] [PubMed] 27. Iqbal, M.; Hui, Z.; Khalid, M.; Aoyun, L.; Xiong, J.; Yaping, W.; Zhang, J.; Iqbal, M.K.; Rehman, M.U.; Yao, W.; et al. Icariin: A potential compound for recovery of tibial dyschondroplasia affected chicken via up-regulating bmp-2 expression. Biol. Proced. Online 2018, 20, 15. [CrossRef] [PubMed] 28. Li, J.; Bi, D.R. Effects of high dietary vitamin A supplementation on tibial dyschondroplasia, skin pigmentation growth performance in avian broilers. Res. Vet. Sci. 2008, 84, [CrossRef] [PubMed] 29. Zhang, H.; Khalid, M.; Jiang, X.; Yao, W.Y.; Mujahid, I. Effect of Tetramethyl thiuram disulfide (thiram) in relation to tibial dyschondroplasia in chickens. Environ. Sci. Pollut. Res. 2018, 25, [CrossRef] [PubMed] 30. Iqbal, M.K.; Nabi, F.; Mehmood, K.; Rehman, M.U.; Huang, S.; Zhang, H.; Zhang, L.; Ahmad, H.I.; Iqbal, M.; Li, J.; et al. Healing of growth plate cartilage by hypoxia Inducible Factor-1α inhibitor apigenin on thiram induced tibial dyschondroplasia. Pak. Vet. J. 2018, 38, Marikovsky, M. Thiram inhibits angiogenesis slows development of experimental tumours in mice. Br. J. Cancer 2002, 86, [CrossRef] [PubMed] 32. Perry, J.J.P.; Shin, D.S.; Getzoff, E.D.; Tainer, J.A. The structural biochemistry of superoxide dismutases. Biochim. Biophys. Acta 2010, 1804, [CrossRef] [PubMed] 33. Li, J.; Bi, D.; Pan, S.; Zhang, Y. Effect of diet with thiram on liver antioxidant capacity tibial dyschondroplasia in broilers. Br. Poult. Sci. 2007, 48, [CrossRef] [PubMed]

10 Animals 2019, 9, of by authors. Licensee MDPI, Basel, Switzerl. This article is an open access article distributed under terms conditions of Creative Commons Attribution (CC BY) license (