1 G PaAGAP 117 ArfGAP Jensen AtZAC ZAC marker GSII marker GSI ARF C2 Ca 2 + PI-3-P ArfGAP 6 OsAGAP ArfGAP 7 OsAGAP 8 ArfGAP ArfGAP 9 1 Mn g kg

Size: px

Start display at page:

Download "1 G PaAGAP 117 ArfGAP Jensen AtZAC ZAC marker GSII marker GSI ARF C2 Ca 2 + PI-3-P ArfGAP 6 OsAGAP ArfGAP 7 OsAGAP 8 ArfGAP ArfGAP 9 1 Mn g kg"

局韶
7 years ago
Views:

1 Vol 28 Journal of the Graduate School of the Chinese Academy of Sciences January No G PaAGAP * Liu F Wu L Q Wang H et al Cloning and expression analysis of PaAGAP gene from Phytolacca acinosa in response to various kinds of stress J Journal of the Graduate School of the Chinese Academy of Sciences RACE Phytolacca acinosa G ArfGTPase ArfGAP ArfGTPase activating protein cdna PaAGAP PaAGAP 332 CX 16 C C2 PCR PaAGAP PaAGAP ARF ArfGAP Q943 2 clathrin COPI COPII 3 1 GTP GTP G GDP GTP ADP- ribosylation factor Arfs G Arf COPI 2 Arf GEFs ARFGTP ARFGAP ARFGTP KDEL- ARFGTP KKXX KXKXX C COPI ARFGTP ARFGAP 3 GCS1 ArfGAP1 1 ArfGAP 4 ADP- Arf1 Arf1 Arl GTPase Arf GTPase Arf 40% ~ 60% Arf 2 ArfGTPase 5 ArfGAP Arf GTPase Sar1p COPII * AA10Z AA B FN00 wulqi@ gucas ac cn

2 1 G PaAGAP 117 ArfGAP Jensen AtZAC ZAC marker GSII marker GSI ARF C2 Ca 2 + PI-3-P ArfGAP 6 OsAGAP ArfGAP 7 OsAGAP 8 ArfGAP ArfGAP 9 1 Mn g kg ArfGAP ArfGAP ~ 8min 3 ~ 5min 0 1% HgCl 2 6 ~ 8min 3 ~ 5 1 /2 MS 2 1 /2hoagland 3d % PEG mmol / L NaCl 200mmol / L CdCl 2 200mmol / L CdCl mmol / L MnCl 2 800mmol / L 1000mmol / L MnCl 2 4 ~ 48h E coli Topo10 Trizol Invitrogen Taq DNA EZ-T RT-PCR MLV TaKaRa PCR EZ-T RNA cdna 0 1g Trizol RNA 100 L DEPCH 2 O RNA L RNA 6 0 L 10 mol / L Oligo dt 65 10min 200U / L RNasin 0 5 L L 100mmol / L dntp 4 0 L MLV 1 0 L h cdna

3 PaAGAP PCR ArfGAP PaAGAP f TGGGCGTCAGCTAATATTGGAGT PaAGAP r TCTCAGCTTCTCCCATTATGTCATC PCR 50 L 94 5min 94 30s 55 45s 72 90s min PCR cdna 3 - RACE 5 - RACE gene specific primer GSP PaAGAP3 GSP1 CCCGTAAAAGTGAAAGTGTTTGATT PaAGAP5 GSP1 GATGAATTTGAACTTCGGAAACTAT PaAGAP5 GSP2 TGGCATTAGCCGCAGCATTTCCT PaAGAP5 GSP3 GATGTGTGTTCCAAGGCTTCTGTGC 3 RACE PCR 3 -CDS primer A Oligo dt 1 3 RACE PCR cdna 3 3 RACE PCR 50 L 10 PCR Ex2 Taq buffer 5 0 L 10 mol / L PaAGAP3 GSP1 1 L long universal primer short universal primer 1 L 2 5mmol / L dntp 2 L 5U / L Ex-Taq polymerase 0 5 L DNA 1 0 L ddh 2 O min 94 30s 55 30s 72 90s min 5 RACE PCR L PaAGAP 5 GSP1 Oligo dt 6 5 L DEPC Diethypyrocarbonate 5 L 2 5 L dctp 2 -deoxycytidine 5 -triphosphate 2mmol / L 10 L S N A P 24 L 94 2 ~ 3min 1min 1 L TdT 37 10min 65 5 RACE PCR 5 RACE 50 L 10 PCR Ex- Taq buffer 5 0 L 10 mol / L PaAGAP5 GSP mmol / L dntp 2 L 5U / L Ex-Taq polymerase 0 5 L DNA 2 0 L abridged anchor primer AAP 3 L ddh 2 O 36 5 L L 94 5min 94 30s 55 30s 72 90s min 5 RACE 2 1 PaAGAP5 GSP3 abridged universal amplification primer AUAP PaAGAP5 GSP2 AAP PCR cdna 5 PCR PCR 1 0% PCR DNA peasy-t Topo mg / L LB 4 L 1mol / L - -D- 40 L 20g / L D PaAGAP ORF PaAGAP ORF Primer 5 0 PaAGAP F 5 - GATGACTAGCCGCATGGAGCTTGGT -3 PaAGAP R 5 - GGGGGAGGAGGGTTGTTTAGTTTTA-3 PCR PaAGAP 94 5min 94 30s 55 30s 72 1min 30s min T-vector PaAGAP DNAMAN PaAGAP ScanProsite http www expasy ch / tools / scanprosite / TMHMM2 0 http genome cbs dtu dk / services / TMHMM

4 1 G PaAGAP 119 SignalP http genome cbs dtu dk / services / SignalP http www ncbi nlm nih gov / Structure / cdd / wrpsb cgi Clustalx Treev RT-PCR Real-time PCR PaAGAP 3 RT-AGAP f TGCACAGAAGCCTTGGAACA RT-AGAP r CATTTCCTCCAACCTCAACCAT α- Tubulin RT-Tubulin f AAACCGCTCTCTGGACCTTAGC RT-Tubulin r AGTTTGTGGACTGGTGCTCCAC TransStart Green qpcr SuperMix PCR PCR cdna 1 2 L 10 mol / L 0 4 L 2 TransStart Green qpcr SuperMix 10 L 50 Passive Reference Dye 0 4 L 6 8 L 20 L 3 Mx 3000P PCR 2 PCR 95 10min s 60 30s 72 30s PCR PaAGAP cdna RACE ArfGAP GenBank blast 5 RACE AUAP polyg 5 RACE 5 ATG 3 RACE polya polya polya DNAMAN cdna BLAST GenBank ArfGAP ArfGAP GenBank GU PaAGAP PaAGAP F PaAGAP R 1kb T-vector 1039bp PaAGAP ORF 996bp kD 5 02 TMHMM 2 0 PaAGAP sequence number of predicted TMHs 0 SignalP3 0 PaAGAP NCBI CDD conserved domain database CX 16 C G Arf GTPase ArfGAP domain C2 1 PaAGAP C2 GenBank www ncbi nlm nih gov PaAGAP BLAST ArfGAP GTPase 2 AtZAC PaAGAP ArfGAP PaAGAP AGAP ArfGAP AtZAC PaAGAP cdna 76 63% PaAGAP AtZAC ArfGAP ArfGAP domain C2 domain 2 ArfGAP ArfGAP 2 3 PaAGAP Tubulin housekeeping gene Tubulin

5 α-tubulin Real-time PCR β-tubulin 14 α-tubulin Real-time PCR PaAGAP PaAGAP Real-time PCR 1 ArfGTPase 4 C2 G ArfGTPase PaAGAP

7 28 PaAGAP 4h 1 PaAGAP 2 PaAGAP 1 4 PaAGAP PaAGAP PaAGAP 3 G

8 1 G PaAGAP Triiodobenzoic acid TIBA 16 PCR PaAGAP PaAGAP ARF PaAGAP PaAGAP 300mmol / L NaCl 48h PaAGAP 2 2 PaAGAP h Arf GTPase G G Arf GTPase PaAGAP mirna PaAGAP G ArfGTPase 1 Cordulah COP-coated vesicles in intracellular protein transport J C Harter / FEBS Letters Tomas K Three ways to make a vesicle J Molecular Cell Biology Joel Moss Martha Vaughan Molecules in the ARF orbit J The Journal of Bioligical Chemistry Carolin W Rainer B Priska E et al Differential roles of ArfGAP1 ArfGAP2 and ArfGAP3 in COPI trafficking J J Cell Biol G J Jensen R B Lykke-Andersen K Frandsen G I et al Promiscuous and specific phospholipid binding by domains in ZAC a membraneassociated Arabidopsis protein with an ARF GAP zinc finger and a C2 domain J Plant Molecular Biology Chong K Zhuang X ARF-GTPase as a molecular switch for polar auxin transport mediated by vesicle trafficking in root development J Plant Signaling & Behavior Zhuang X Xu Y Chong K et al OsAGAP an ARF-GAP from rice regulates root development mediated by auxin in Arabidopsis J Plant Cell and Environment Xue S G Chen Y X Lin Q et al Phytolacca acinosa Roxb Phytolaccaceae A new manganese hyperaccumulator plant from Southern China J Acta Ecologica Sinica in Chinese J Tie B Q Yuan M Tang M Z Phytolacca americana L A new manganese accumulator plant J Journal of Agro-Environment Science in Chinese Phytolacca ameircaca L Mn J Nie F H Wu C B Wu S T Characteristics of Phytolacca acinosa accumulating Cd J Journal of Zhejiang Forestry College in Chinese J Bendtsen J D Nielsenh Vonh G et al Improved prediction of signal peptides SignalP 3 0 J J Mol Biol Nielsenh Engelbrecht J Brunak S et al Identification of prokaryotic and eukaryotic signal peptides and prediction of their cleavage sites J Protein Eng

9 Hu R B Fan C M Fu Y F Reference gene selection in plant real-time quantitative reverse transcription PCR qrt-pcr J Journal of Agricultural Science and Technology in Chinese PCR J Memon A R The role of ADP-ribosylation factor and SAR1 in vesicular trafficking in plants J Biochimica et Biophysica Acta BBA - Biomembranes Reed R C Brady S R Muday G K Inhibition of auxin movement from the shoot into the root inhibits lateral root development in Arabidopsis J Plant Physiol Pasternak T Rudas V Potters G et al Morphogenic effects of abiotic stress reorientation of growth in Arabidopsis thaliana seedlings J Environ Exp Bot Cloning and expression analysis of PaAGAP gene from Phytolacca acinosa in response to various kinds of stress LIU Fang 1 WU Liang-Qi 1 WANG Hui 1 ZHANG Yuan-Ya 2 CHAI Tuan-Yao 1 1 College of Life Science Graduate University Chinese Academy of Sciences Beijing China 2 China University of Mining & Technology Beijing China Abstract A full-length cdna of an ArfGAP PaAGAP encoding 332 amino acids was cloned from Phytolacca acinosa by using methods of homology-based cloning and RACE PaAGAP is predicted to contain a CX 16 C type zinc finger domain and a C2 domain Real-time PCR analysis revealed that the expression of PaAGAP was up-regulated in response to low temperature osmotic salt and heavy metal stresses indicating a potential role of PaAGAP in the plant stress response that involves the inactivation of ARF and the inhibition of polar auxin transport Key words Phytolacca acinosa ArfGAP zinc finger stress expression

Syngene GBOXHR Retsch MM400 KQ DE Eppendorf Table 1 The sources of Astragali Radix and Hedysarum Radix No. 1 AMM2011_NMGTY Astr

Syngene GBOXHR Retsch MM400 KQ DE Eppendorf Table 1 The sources of Astragali Radix and Hedysarum Radix No. 1 AMM2011_NMGTY Astr PCR 龙平, 崔占虎, 李虔全, 徐建平, 张春红, 周立社 * *, 李旻辉 ( 包头医学院, 内蒙古包头 014060) DNA 30 28 DNA trnl-trnf PCR PCR 136 bp 323 bp 10% PCR PCR Astragalus membranaceus Fisch. Bge. var. mongho- licus Bge. Hsiao A. membranaceus