367 (human lens epithelial cells, HLEC) E (cyclin dependent kinase 2, CDK 2 ) (cyclin2 dependent2kinase inhibitor, CKI) p21, HLEC (posterior capsule opacification, PCO) HLEC HLE2B3, ; ; RNA (reverse transcription polymerase chain reaction, RT2PCR) E CDK 2 p21 mrna ; Western blot E CDK 2 p21 : HLE2B3 G 1,3315 % ; S,4611 % ; G 2, 2014 % ; S G 2 6615 %RT2PCR : HLE2B3 ( E CDK 2 ) mrna, E S p21 mrna E, p21 Western blot :CDK 2 S,G 1 G 2 S CDK 2 E CDK 2 p21 mrna HLE2B3 E CDK 2 p21,e CDKCKI ; ; ; E; Detection of cell cycle related gene expression in cultured immortalized human lens epithelial cell WU Mingxing 3, LI Shaozhen, ZENG Junwen, GAO Jinsong, LIU Yizhi. 3 Zhongshan Ophthalmic Center, Sun Yat2sen University, Guangzhou 510060, China Corresponding author :WU Mingxing ( Email : wumx63 @21cn. com) Abstract Objective To investigate the gene expression of cyclin E, cyclin2dependent2kinase 2 (CDK 2 ) and CDK inhibitor ( CKI) p21 during cell cycle of the human lens epithelial cell ( HLEC) for elucidating the molecular mechanism of proliferation of HLEC and the formation of posterior capsular opacification ( PCO). Methods HLE2B3 cell line was cultured in vitro under MEM medium with 15 % fetal bovine serum. The cell cycle was analyzed by flow cytometry ( FCM) system. The cell cycle was synchronized by double thymidine block method. The mrna was detected by reverse transcription polymerase chain reaction ( RT2PCR). The total RNA was separated from cells at different phases. Protein expression was detected with immunohistochemistry or western blotting method. The primary antibodies were rabbit anti2human cyclin E polyclonal antibody, mouse anti2human p21 and CDK 2 monoclonal antibody, respectively. Results FCM showed that G 1 phase was about 33. 5 %, S phase cells about 46. 1 %, and the G 2 phase about 2014 %, total cells in G 2 and S phase were over 60 %. It was suggested that HLE2B3 cells have relatively more capacity of mitosis than normal LEC. The mrna expression of CDK 2 was found at all phases of cell cycle during synchronization, but cyclin E mrna only expressed during synchronized cells, and not expressed in non2synchronized cells. Only S phase cells could express very low p21 mrna. There was no any positive signal of cyclin E by immunohistochemistry or western blot. CDK 2 protein : (39870803) ; 211 (98012) :510060, ( ), ( ) : ( Email :wumx63 @21cn1com)
368 detected by Western blot expressed at all phases. The p21 protein was expressed in a few cells by immunohistochemistry, but p21 could not detected by western blotting. These results showed cyclin E and CDK 2 were higher expressed than p21 in transcriptional level and translational level. Conclusions There is mrna expression of cyclin E, CDK 2 and p21 during the cell cycle in HLE2B3 cell line, but it means the imbalance of the association of CDK and CKI. These results suggest that the imbalance expression of cyclin, CDK and p21 be the molecular mechanism of PCO. Key words Lens ; Epithelial cells ; Cell culture ; Cyclins E; Cyclin2dependent kinases HLEC HLE2B3 [5 ] ;, MEM (modified Eagle medium, Highclone (cyclin dependent kinase, CDK) ),N22 2N 22 2 (hydro2 CDK xyethylpiperazine ethane sulfonic acid, HEPES) (cyclin) ( Fluka ), ( ( cyclin ), ( dependent kinase inhibitor, CKI) CDKAmersham ) ; Trizol ( Gibco BRL [123, CDK ] ) ; RNA ( Promega p21 CKI, CDK ) Titan [3 ] DNA (Titan TM One tube RT2PCR System) ( Roche, G 1 / S G 2 / M ) ; 2 ( streptavidin2, / CDK peroxidase technique,sp) ( CKI, ) ; (, G 1 Borhringer Mannheim ) ;,G 1,, G 1 E CDK 2 p21 S G 1 / S, ( NeoMarker ) ; [1 / CDK 2 ], ( ( posterior capsule opacifi2 cation, PCO), (lens 1. : HLE2B3 15 %, epithelial cells, LEC) 100 mg/ L 125 mg/ L MEM ; G 1,, 5 %CO 2,37 PCO,,, PCO PCO, 35 min, PCO, ( 10 % [4 ] PCO ),,, G 1 / S, 4 30 min - 20 2 h - 40 2 h ( reverse transcription2 polymerase chain reaction, RT2PCR) 37, (1 200 r/ min) (Western blot), 35 min, ( human lens, epithelial cells, HLEC) E 2. HLE2B3 CDK 2 p21 mrna :,70 % NEB ),,4 PBS(pH 714) 3, 1 10 9 / L,, RNA A,37 30 min,
369 800 l,4 30 min,, 488 nm, DNA [ 6 ] 4. : SP 100 60 %, 215 mol/ L mg/ L,100 % 18 h, G 1 / S,PBS 1 2, 10 h : p21 215 mol/ L 18 h,, E 1 100 ;,PBS 1 2, G 1 ; 60 min, PBS 3, 5 min, ( G 1 MEM, ), 30 min,pbs 3, 3 h, S ;G 1 5 min, 2 2 215 mol/ L 18 h, G 2, 20 min,pbs 3, 5 min, 3, 3 ( 3, 3 2 80 %diaminbezidine, DAB),, 3. RNA RT2PCR : RNA Trizol RNA :p21 E RNA 260 280 nm ( A ),, RNA RNA 5. Western blot : 85 E CDK 2 p21 :,, 2030 bp 311 358 309 bp ( 40 ) 60 min, 200 V E : : 5 2TTT CTTTGACCGGTATATGGCG23 ; : 5 2AGATTT GCTGGGGATACTGCG23 CDK 2 : : 5 2GCT TTTGGAGTCCCTGTTCGTAC23 ; : 5 2TCG TAGTGCAGCATTTGCGAT23 p21 : :5 2CTG GAGACTCTCAGGGTCGAA23 ; : 5 2TTAGGA 1 1 000), 1 h 015 % Tween 20 PBS ACCTCTCATTCAACCGC23 2, :5 2ACCCCCACTGAAAAAGATGA23 ; : 5 2ACTTTCAAACCTCCATGATG23 120 bp RT2PCR Titan RNA, ( HLE2B3 E ),AMV (AMV2Rtase), cdna,,dna,3 4 d, 93 3, 1 min ; 32, 1 7 min 2 h,3 015 mg/ L 115 % 4 d, 115 h ( 4 V/ cm), DNA, 10 min,pbs 3, 5 min,, PBS, 2 ( Pharmacia ) 13 V 34 h, 5 % PBS 1 h 1 h, (, X, p21 CDK 2 11 HLE2B3 : HLE2B3, min,,93 45 s,55 45 s,72 (1) 1 34,
370 90 %, LEC,1994 Andley [5 ] HLE2B3,,1 h,, SV240T, 1, (2) 21 HLE2B3 : PCO LEC, HLE2B3 G 1,3315 % ; S,4611 % ; G 2,2014 % S,LEC G 2 6615 %, HLE2B3 7 8 HLE2B3 LEC 215 mol/ L 2,90 %,HLE2B3 HLEC G 1 / S, 3 h 70 %, S, 8 h G 2 / M 70 %, 10 h G 1 75 %80 % [7,8 ] HLEC 3, LEC, LEC,HLE2B3 HLE2B3 E CDK 2 LEC [5 p21 mrna ] TRIzol RNA, A 260 / LEC E CDK 2 p21 A 280 118210,4g, 4 V/ cm, 115 h, 5 S 18 S 28 S,, RNA RT2PCR, CDK G 1 S G 2 HLE2B3 E CDK 2 mrna CDK CKI CDK 2 mrna S E CDK 2 G 1 / S [1 p21 mrna (35) ] p21 CKI, [3 HLE2B3 E CDK 2 CDK ] p21 [9,10 11SP : ] Reneker E, Overbeek [9 ] p21 p21,,, A, (6), PDGF2A LEC 21Western blot :HLE2B3 A/ D 2,S, CDK 2 CDK 2 S, A LEC,G 1 G 2 S ;, A,CDK 2, LEC Fromm Overbeek [10 ] (7), LEC E p21 CDK 2,, LEC LEC CDK LEC G 1 S, E HLE2B3 LEC Ad212 CDK 2 p21 mrna, LEC SV40T DNA E CDK 2 mrna,
371 CDK 2 E, p21 S mrna LEC E CDK 2 p21, CDK 2 Western blot, Western blot E, E, ; E p21 S,, CDK, E CDK 2 p21,hle2b3 E CDK 2 p21,pco CDK CKI, CDK CKI ( 17 6-4) 1 Koff A, Giordano A, Desai D, et al. Formation and activation of a cyclin E2cdk2 complex during the G 1 phase of the human cell cycle. Science,1992,257 :168921694. 2 Reed SI. Control of the G 1 / S transition. Cancer Surv,1997,29 :7223. 3 XiongY, Hannon GJ, Zhang H, et al. p21 is a universal inhibitor of cyclin kinases. Nature, 1993,366 :7012704. 4 Apple DJ, Solomon KD, Tetz MR, et al. Posterior capsule opacification. Surv Ophthalmol,1992,37 :732116. 5 Andley UP, Rhim JS, Chylack LT Jr, et al. Propagation and immortalization of human lens epithelial cells in culture. Invest Ophthalmol Vis Sci,1994,35 :309423102. 6 Gui JF, Lane WS, Fu XD. A serins kinase regulates intracellular localization of splicing factors in the cell cycle. Nature, 1994, 369 : 6782682. 7 Fleming TP, Song Z, Andley UP. Expression of growth control and differentiation genes in human lens epithelial cells with extended life span. Invest Ophthalmol Vis Sci,1998,39 :138721398. 8 Mukhopadhyay P, Bhattacherjee P, Andom T, et al. Expression of prostaglandin receptors EP4 and FP in human lens epithelial cells. Invest Ophthalmol Vis Sci,1999,40 :1052112. 9 Reneker LW,Overbeek PA. Lens2specific expression of PDGF2A alters lens growth and development. Dev Biol, 1996,180 : 5542565. 10 Fromm L, Overbeek PA. Regulation of cyclin and cyclin2dependent kinase gene expression during lens differentiation requires the retinoblastoma protein. Oncogene,1996,12 : 69275. ( :2001202212) ( : ) ( ),,,,, : (1) 6 ; (2) ; (3), ( ), : (1) ; (2) ; (3) : 700 1102 ; :200001 ; :021253530870 ; Email :zdy @shanghai2conbio. com