1 : MHC- cdna 9 MHC [ 1 ] MHC MHC, T 1 ( TCR),,, 1. 1, ( 200 g), 7 d, 1 d SNELL MHC [ 2 ], MHC 1. 2 RNA MHC 1990 HASHIMOTO [ 3 ] ( Cyprinus

Size: px

Start display at page:

Download "1 : MHC- cdna 9 MHC [ 1 ] MHC MHC, T 1 ( TCR),,, 1. 1, ( 200 g), 7 d, 1 d SNELL MHC [ 2 ], MHC 1. 2 RNA MHC 1990 HASHIMOTO [ 3 ] ( Cyprinus"

调叹汪
7 years ago
Views:

1 South China Fisheries Science Vol. 7, No. 1 Feb., 2011 doi: / j. issn MHC- cdna 1, 2, 2, ,,, ( 1., ; 2., ) : ( RACE), bp ( Rachycentron canadum) MHC- cdna 76 bp 5 ( UTR) 189 bp 3 UTR bp ( ORF), 354, kda, MHC-,, ( Homo sapiens) MHC % 67. 1%, CP/ TM/ CYT Real-time PCR, MHC-, ; ; : ; MHC- ; cdna; : S 943 : A : ( 2011) Full-length cdna cloning and tissue expression of major histocompatibility complex( MHC) - from cobia ( Rachycentron canadum) ZHANG He 1, 2, MAO Lina 2, FENG Juan 2, GUAN Yueqiang 1, XU Haidong 2, SU Youlu 2 ( 1. College of Life Science, Hebei University, Baoding , China; 2. South China Sea Fisheries Research Institute, Chinese Academy of Fishery Sciences, Guangzhou , China) Abstract: We cloned the MHC- gene from cobia Rachycentron ( canadium) by homology cloning and RACE PCR. The full-length cdna of MHC- comprises bp with a 76 bp 5 untranslated region ( UTR), a 189 bp 3 UTR and a bp open reading frame ( ORF), encoding a polypeptide of 354 amino acid residues with a predicted molecular weight of kda and a theoretical isoelectric point of According to the phylogenetic tree and amino acid similarity comparison, the homology of MHC- amino acids between cobia and some known fishes and human ( Homo sapiens) varies from 27. 9% to 67. 1%. The putative protein sequence shows some important features including leader peptide, 1, 2, 3, CP/ TM/ CYT regions and conserved cysteines, etc.. Real-time PCR result indicates that MHC- expresses in all detected tissues at different expression levels. High expression is detected in head kidney; moderate expression is detected in gill, spleen and intestine; while low expression is detected in heart, brain and muscle. Key words: cobia ( Rachycentron canadum) ; MHC- ; full-length cdna; tissue-specific expression ( major histocompati- bility complex, MHC), : ; : : ( ) ( 2007ZD10) : ( ), zhanghe1982smile@ 163. com : juanf@ 21cn. com

2 1 : MHC- cdna 9 MHC [ 1 ] MHC MHC, T 1 ( TCR),,, 1. 1, ( 200 g), 7 d, 1 d SNELL MHC [ 2 ], MHC 1. 2 RNA MHC 1990 HASHIMOTO [ 3 ] ( Cyprinus carpio) MHC, MHC RNA MHC 1. 3 cdna MHC MHC RNA 10 g ( oligo-dt MHC I MHC-, 1) 2 L ( 10 pmol L - 1 ), RT- 2 ( 2 -microgolubin, 2 m), MHC MHC-, 2 m MHC MHC- MHC ( Paralichthys olivaceus) ( Sparus aurata) 1993 GRIMHOLT [ 4 ] ( Salmo salar) MHC- cdna, ( Oncorhynchus mykiss) [ 5 ] [ 6 ] ( Stizostedion vitreum) [ 7] ( Ctenopharyngodon idellus) [ 8 ] MHC- cdna MHC-, ( Perciformes) 1. 5 MHC- ( Percoidei) ( Rachycentridae) ( Rachycentron),, RCMC32AOUT RCMC32AIN RCMC52AOUT RC- [ 9] MC52AIN, 1 ( semi-nested), PCR, cdna ( rapid am-, plification of cdna ends, RACE) [ 10 ] 5 PCR PCR,,,, DNAstar ( V 5. 01) [ ] MHC MHC- MHC- cdna Blast. cgi) cdna, DNAstar MHC- cdna MHC-, PHDsec program 0. 3 g, Trizol ( TaKaRa) RNA, PCR cdna ( Psetta maxima) MHC-, CLUSTAL W 2. 0 RCMC1AF RCMC1AR (, 1), MHC- PCR 3, NCBI ( http: blast. ncbi. nlm. nih. gov/ BLAST, MHC-,, CLUSTAL W 2. 0 MHC, MEGA 4. 1

3 10 7 primer 1 Tab. 1 Primer sequences used in tests ( 5 3 ) nucleotide sequence scope of application RCMC1AF GGATGAAGGGACAAATGA RCMC1AR GATAGAAACCTGTAGCGTG oligo-dt AAGCAGTGGTATCAACGCAGAGTACT ( 30) VN SMART 3a CAGAGTACTTTTTTTTTTTTTTTT 3 RACE RCMC32AOUT TRACAGAGGTTKGAACACACAG 3 RACE RCMC32AIN AAGTCTCCCTCCTCTTCAGTCAGC 3 RACE RCMC52AOUT GCTGACTGAAGAGGAGGGAGAC 5 RACE RCMC52AIN GRWKTGTSYTGASTGGGTGAAG 5 RACE olido-dg GGGGGGGGGGGGGGG ( A/ T/C) 5 RACE -ActinF TGCTGTCCCTGTATGCC RT-PCR -ActinR TGATGCTGTTGTAGGTGGTC RT-PCR J1AF GCTGACTGAAGAGGAGGG RT-PCR J1AR TGAATGGGATGAAGGGAC RT-PCR 1. 7 MHC- Real-time PCR kda, ( leader pep- MHC- tiade) / / 3 ( 200 g) ( CP/TM/ CYT), , RNA 52, QPCR ( Real-time quantitative PCR), -ActinF - ActinR PCR, ( 330 KKKS), CP/ SYBR Green I Mastercyclerep realplex PCR ( ( 21 SMK 56 TKR 171 TQR 265 ) SVK 300 SEK 333 SDK), 4 Mas- TM/ CYT 3 tercyclerep realplex System, 2 - CT MHC- GMQGAL 82 GISLSN) 3 RACE 5 RACE, bp DNAstar, MHC- ( Homo sapiens) cdna bp ( 1), 76 ( 67. 1% ) ( 63. 5% ) bp 5 UTR 189 bp 3 UTR bp ( 60. 9% ) ( 27. 9% ) ( 2) 1 N- ( NQTG) CP/TM/ CYTQ 1 TM/ CYT 6 C- 3 CP/ ( 289 TKLD 298 TNSE 342 SNPE), ( 68 KVVADDPQY 267 KPEDWRRY), 1 2 N- ( 11 DNAstar, MHC- MHC MHC- ( Mus musculus) MHC- MHC- cdna Clustal W ( 1), ( 2) 3,

4 1 : MHC- cdna 11 1 MHC- cdna ( ATG) ( TGA), ;, ; <, >, Fig. 1 3 ( 1 2 3) cdna sequence of MHC- from cobia and deduced amino acid sequence The start and stop codons are shown in shadow; the start amino acid of different region is underlined. Lowercase letters indicate nucleotide sequence; capital letters indicate amino acid sequence; " < " indicates the initial position of the region; " > " indicates the final position of the region; these regions include the leader peptide, 1, 2 and 3 regions as well as CP / TM/ CYT region ( connecting peptide, transmembrane and cytoplasm) MEGA 4. 1 ( 3),,, ( 2. 3 MHC-, 2,, MHC, cdna, -actin ( J1AF J1AR) Real-time PCR, MHC- MHC-, MHC- ( 1 2 3) ; RACE PCR ; ( 4) MHC bp, 76 bp 3 ) MHC I CD8 + T TCR, TCR CP/ TM/CYT MHC, UTR 189 bp 3 UTR bp ( ORF), 354 MHC-I 4, MHC-I MHC MHC

5 MHC- Tab. 2 Homology analysis of amino acids of MHC- from cobia and other reported animals species / % homology accession No. references ( Psetta maxima) ABM92962 WANG ( 2008) [ 14] ( Stizostedion vitreum) AAL11412 ( Paralichthys olivaceus) BAD13368 SRISAPOOME ( 2004) [ 15] ( Sparus aurata) DQ ( Poecilia reticulata) CAA90791 ( Oryzias latipes) BAB83849 MATSUO ( 2002) [ 16] ( Epinephelus akaara) ABX80521 ( Aulonocara hansbaenschi) AAD37812 SATO ( 1997) [ 17] ( Takifugu rubripes) AAC41238 TIMON ( 1998) [ 18] ( Oncorhynchus mykiss) AAG25199 AOYAGI ( 2002) [ 19] ( O. gorbuscha) BAA09553 ( Gadus morhua) AAL14532 MILLER ( 2002) [ 20] ( Salmo salar) AAN75116 GRIMHOLT ( 2002) [ 21] ( Cyprinus carpio) CAA62497 ( Ctenopharyngodon idellus) AAS76087 ( Barbus intermedius) CAD44955 KRUISWIJK ( 2004) [ 22] ( Ictalurus Punetaus) AAG29241 ANTAO ( 2001) [ 23] ( Homo sapiens) CAC15502 ( Ginglymostoma cirratum) AAC60347 BARTL ( 1997) [ 24] ( Triakis scyllium) AAB97322 OKAMURA ( 1997) [ 25] 1 2 SVK 300 SEK 333 SDK), ( 19 TM/ CYT ), 3, MHC- 1 2, 1 3 ( KVVADDPQY 267 KPEDWRRY) 2 MHC I 1 N- ( 11, N- ( NQTG), MHC % 67. 1% CP/ TM/CYTQ,, ( 330 KKKS), CP/ TM/ CYT C % 36%, ( 21 SMK 56 TKR 171 TQR CP/ ( 289 TKLD 298 TNSE 342 SNPE), GMQGAL 82 GISLSN), MHC % 67. 1%,, %

7 14 7 Fig. 2 2 MHC- : 1 2 CP / TM/CYT * ; : ;. ; ; Sequence alignment of predicted MHC- amino acid from cobia and MHC- amino acid from other known species Regions corresponding to the putative leader peptide, 1, 2 and CP /TM/ CYT regions are shown above the sequences. * means that the residues or nucleotides in that column are identical in all sequences in the alignment. " : " means that conserved substitutions have been observed. ". " means that semi-conserved substitutions are observed. The dark shadow areas indicate no significant difference between cobia and other fish species; parts indicate significant difference between cobia and other fish species. the light shadow 3, MEGA , MHC-, 2, Real-time PCR MHC-I

8 1 : MHC- cdna 15 Fig. 3 3 Clustal W 2. 0 MEGA 4. 1 MHC- ( 3 ) Phylogenetic tree of amino acid sequences of full-length MHC- gene ( 3 region) by Clustal W 2. 0 and MEGA Fig. 4 MHC-I Tissue expression of MHC-I gene from cobia, MHC-I, MHC- ; ; I MHC-I Northern blotting MHC-I

9 16 7 [ 9]., MHC-I van ERP [ 6 ] MHC-I YANG [ 8] MHC-I, MHC-I MHC-II,, MHC-I,, [ 26 ] MHC-II, MHC-I,, : nol, 1996, 20 ( 6) : [ 6] van ERP S H M, DIXON B, FIGUEROA F, et al. Identification and characterization of a new major histocompatibility complex class gene in carp ( Cyprinus carpio L. ) [ J]. Immunogenet, 1996, 44 ( 1 ) : [ 7] FUJIKI K, BOOMAN M, DIXON E C, et al. Cloning and characterization of cdna clones encoding membrane-bound and potentially secreted major histocompatibility class receptors from walleye ( Stizostedion vitreum) [ J]. Immunogenet, 2001, 53 ( 9) : [ 8] YANG Tianyao, HAO Huifang, JIA Zhenhu, et al. Characterization of grass carp ( Ctenopharyngodon idellus) MHC class domain lineages [ J]. Fish Shellfish Immunol, 2006, 21 ( 5) : [ M ]. : 1987 : MENG Qingwen. Ichthyology [ M]. Shanghai: Shanghai Science and Technology Publishing Press, 1987: ( in Chinese) [ 10]. [ J]. 2007, 29 ( 1) : GOU Xiaowei, OU Youjun, LIAO Rui. Present status on studies of cobia Rachycentron canadum in China [ J]. Mar Fish, 2007, 29 ( 1) : ( in Chinese) [ 11],,. [ J]., 2003, 23 ( 4) : JIAN Jichang, WU Zaohe, CHEN Gang, et al. Isolation and characteristics of pathogen of vibriosis in cobia ( Rachycentron canadum) maricultured in cage [ J]. Chinese J Vet Sci, 2003, 23 ( 4) : ( in Chinese) [ 12],. 1 [ J]., 2006, 13 ( 5 ) : GUO Mingyuan, LIU Guangfeng, FENG Juan. Identification and [ 1]. [ M]. :, phylogenetic analysis of a pathogenic Vibrio sp. isolated from 2000 : ZHOU Guangyan. Principles of immunology [ M ]. Shanghai: Rachycentron canadum [ J]. J Fish Sci China, 2006, 13 ( 5 ) : ( in Chinese) Shanghai Science and Technology Publishing Press, 2000: 63 - [ 13],, ( in Chinese) [ J]., 2006, 13 ( 6) : [ 2]. [ M ]. : CHANG Ouqing, SHI Cunbin, MA Hong, et al. Histopathological 1997 : study on lymphocystis disease of Rachycentron canadum [ J]. J WANG Chongqing. Molecular immunology [ M ]. Beijing: Peking Fish Sci China, 2006, 13 ( 6 ) : ( in Chinese) University Press, 1997: ( in Chinese) [ 3] HASHIMOTO K, NAKANISHI T, KOROSAWA K. Isolation of carp [ 14] WANG Chuanjuan, ZHANG Xiaohua, JIA Airong, et al. Identification of immune-related genes from kidney and spleen of turbot, genes encoding major histocompatibility complex antigens [ J]. Proc Natl Acad Sci USA, 1990, 87 ( 17) : Psetta maxima ( L. ), by suppression subtractive hybridization following [ 4] GRIMHOLT U B, HORDVIK I, FOSSE V M, et al. Molecular cloning of major histocompatibility complex class cdnas from Atlantic challenge with Vibrio harveyi [ J]. ( 7) : J Fish Dis, 2008, 31 salmon ( Salmo salar) [ J]. Immunogenet, 1993, 37 ( 6 ) : [ 15] SRISAPOOME P, OHIRA T, HIRONO I. Cloning, characterization 473. and expression of cdna containing major histocompatibility [ 5] HANSEN J D, STRASSBURGER P, DU PASQUIER L. Conservation complex class I, II alpha and II beta genes of Japanese flounder of an alpha 2 domain within the teleostean world, MHC class I Pariehthys olivaceus [ J]. Fish Sci, 2004, 70 ( 2) : from the rainbow trout Oncorhynchus mykiss [ J ]. Dev Comp Immu- [ 16 ] MATSUO M Y, ASAKAWA S, SHIMIZU N, et al. Nucleotide sequence of the MHC class I genomic region of a teleost, the medaka ( Oryziazs latipes) [ J]. Immunogenet, 2002, 53 ( 10 / 11 ) : [ 17] SATO A, KLEIN D, SULTMANN H, FIGUEROA F, et al. Class I MHC genes of cichlid fishes: identification, expression, and polymorphism [ J]. Immunogenet, 1997, 46 ( 1) : [ 18 ] TIMON M, ELGAR G, HABU S, et al. Molecular cloning of major histocompatibility complex class I cdnas from the pufferfish Fugu rubripes [ J]. Immunogenet, 1998, 47 ( 2) : [ 19] AOYAGI K, DIJKSTRA J M, XIA C, et al. Classical MHC class I genes composed of highly divergent sequence lineages share a single locus in rainbow trout ( Oncorhynchus mykiss) [ J]. J Immunol,

10 1 : MHC- cdna , 168 ( 1) : [ 20 ] MILLER K M, KAUKINEN K H, SCHULZE A D. Expansion and contraction of major histocompatibility complex genes: a teleostean example [ J]. Immunogenet, 2002, 53 ( 10 /11) : [ 21] GRIMHOLT U, DRABLOS F, JORGENSEN S M, et al. The major histocompatibility class I locus in Atlantic salmon ( Salmo salar L. ) : polymorphism, linkage analysis and protein modelling [ J]. Immunogenet, 2002, 54 ( 8) : [ 22] KRUISWIJK C P, HERMSEN T, FUJIKI K, et al. Analysis of genomic and expressed major histocompatibility class I and class II genes in a hexaploid Lake Tana African large barb individual ( Barbus intermedius) [ J]. Immunogenet, 2004, 55 ( 11 ) : [ 23] ANTAO A B, WILSON M, WANG J, et al. Genomic organization and differential expression of channel catfish MHC class I genes [ J]. Dev Comp Immunol, 2001, 25 ( 7 ) : [ 24] BARTL S, BAISH M A, FLAJNIK M F, et al. Identification of class I genes in cartilaginous fish, the most ancient group of vertebrates displaying an adaptive immune response [ J]. 1997, 159 ( 12) : Immunol, [ 25] OKAMURA K, OTOTAKE M, NAKANISHI T, et al. The most primitive vertebrates with jaws possess highly polymorphic MHC class I genes comparable to those of humans [ J]. 1997, 7 ( 6) : Immunity, [ 26]. [ M ]. 2. : 2001: JING Boquan. Cellular and molecular immunology [ M]. 2nd ed. Beijing: Science Press, 2001: ( in Chinese)

Microsoft Word 曹伏君_new_.doc

Microsoft Word 曹伏君_new_.doc 45 2 Vol.45, No.2 2014 3 OCEANOLOGIA ET LIMNOLOGIA SINICA Mar., 2014 (Lethrinus erythropterus) * ( 524025) Wright (Lethrinus erythropterus),,,, ; ; ; Q954.56 doi: 10.11693/hyhz20140100011 (Lethrinus erythropterus)