42 11 [ Lysozyme( EC ) ] FLEMING 1922 g, N-, g 6 [ 1] : c ( c-type) g ( g-type) 1 i ( i-type) ( p-type) , c [ 2-3 ] ; i c ; g (

Size: px

Start display at page:

Download "42 11 [ Lysozyme( EC ) ] FLEMING 1922 g, N-, g 6 [ 1] : c ( c-type) g ( g-type) 1 i ( i-type) ( p-type) , c [ 2-3 ] ; i c ; g ("

野成
7 years ago
Views:

1 South China Fisheries Science Vol. 11, No. 2 Apr., 2015 doi: / j. issn g cdna 1, 2, 2, 2 1, 2,, 2 2, ( 1., ; 2., ) : g ( Megahbrama amblycephala), ( rapid amplication of cdna ends, RACE) g cdna 719 bp cdna, 71 bp 5 ( untranslated regions, UTR) 90 bp 3 UTR 558 bp ( open reading frame, ORF) ; g,, ( Ctenopharyngodon idella) g PCR g,,,, g, g : ; ; ; ; : S : A : ( 2015) Molecular cloning and expression analysis of g-type lysozyme gene from blout snout bream ( Megahbrama amblycephala) ZHANG Qiong 1, 2, SUN Shengming 2, LI Bing 2, JIANG Gaozhong 1, 2, ZHU Jian 2, GE Xianping 2 ( 1. Wuxi Fishery College, Nanjing Agricultural University, Wuxi , China; 2. Freshwater Fisheries Research Center, Chinese Academy of Fishery Sciences, Wuxi , China) Abstract: We cloned the cdna encoding g-type lysozyme from blout snout bream ( Megahbrama amblycephala) by using rapid amplication of cdna ends ( RACE) approach. The full length cdna of g-type lysozyme was 719 bp, of 71 bp, consisting of a 5 untranslated region a 3 untranslated region of 90 bp and an open reading frame of 558 bp. Based on amino similarity comparison, the three catalytic sites and four substrate binding sites were highly conserved among different fishes, and phylogenetic tree analysis indicates that g-type lysozyme of M. amblycephala had close relationship with Ctenopharyngodon idella. Quantitative real-time PCR analysis shows that the g-type lysozyme gene was expressed in most tissues of M. amblycephala with highest expression in intestinal. After ammonia-n challenge and recovery, the relative expression levels of g-type lysozyme in liver and brain were higher than that in the control at 12 th, 24 th, 48 th and 72 nd hour of post-stress, followed by a gradual decrease at 72 th hour of recovery. By contrast, the relative expression level of g-type lysozyme in gill was lower than that in the control from 3 rd hour to 72 nd hour of post-stress, but peaked at 72 nd hour of recovery. It is speculuted that g-type lysozyme gene involved in molecular processes of ammonia-n stress. Key words: Megahbrama amblycephala; lysozyme; gene cloning; ammonia-n stress; tissue expression : ; : : ( CARS-46-14) ; ( 2012 BAD25 B07) ; ( 2013JBFR06, 2013A08XK01) : ( ),, @ qq. com : ( ), jianggz@ ffrc. cn

42 11 [ Lysozyme( EC3. 2. 1. 17) ] FLEMING 1922 g, N-, g 6 [ 1] : c ( c-type) g ( g-type) 1 i ( i-type) ( p-type) 3 1. 1, c [ 2-3 ] ; i c ; g ( 15 0.

2 42 11 [ Lysozyme( EC ) ] FLEMING 1922 g, N-, g 6 [ 1] : c ( c-type) g ( g-type) 1 i ( i-type) ( p-type) , c [ 2-3 ] ; i c ; g ( ) g 500 [ 4], 2 ; 2 2 d Glu97 Asp84 Asp101, CANFIELD g, h g, ( LC 50 ) mg L - 1, ( Danio rerio ) ( Gadus morhua) ( Oncorhynchus keta), 20 mg L mg L - 1 [ 5-8 ], 3 40 c, g 6 ( 300 L),, ( Ctenopharyngodon idella) [ 9 ] ( Scophthalmus maximus) [ 10 ] ( Oplegnathus fasciatus) [ 1 1] ( Cyprinus carpio) [ 12 ] ( Siniperca chuatsi) [ 13 ] 1. 2 ( Megahbrama amblycephala) RNA,,, 1. 5 ml RNAiso Plus, [ ] RNA,, RNA g 35 cdna 1 g,, NCBI [ ] 3 RACE 5 RACE ( 1),,, RNA, PCR, TaKaRa g 3 5, 1. 5%, N- -D- 16 ( NMDA) pmd18-t, DH5, [ 18 ], g BioSune mg L - 1, mg L - 1, ph 40%,,, cdna, PCR g cdna

3 2 : g cdna 43 primer 1 Tab. 1 Primers and their sequences used in gene cloning and expression primer sequence usage LZM F1 TAAAGTTGGCAGAGCAAAGCAG g-type lysozyme 3 RACE LZM F2 CAGCATGTCACACAAGGAACTG LZM R1 CATTGGAGTAATCGCCACCTGT g-type lysozyme 5 RACE LZM R2 TGCA CCTACTGGAGTGTGATAG LZM qf TAAAGTTGGCAGAGCAAAGCAG g-type lysozyme qpcr LZM qr TGGAGTGTGATAGCGTTTGTCA -actin-f TCGTCCACCGCAAATGCTTCTA -actin qpcr -actin-r CCGTCACCTTCACCGTTCCAGT Compute pi/mw ( web. http: expasy. org/compute_ pi/ ) ( P < ) ORFFinder ( http: www. ncbi. nlm. nih. gov/ gorf /gorf. html) g cdna, Conserved Domains( http: www. ncbi. nlm. nih. gov/structure /cdd /wrpsb. cgi ), DNAMAN 3,, MEGA PCR g RNA, TaKaRa PrimeScript TM RT reagent Kit cdna, 2. 1 g 3 RACE 5 RACE g cdna LZM qf LZM qr, bp; 151 -actin ( AY170122), -actin-f 35, Bio- -actin-r( 1), 152 bp Sune 719 bp g PCR, cdna, 71 bp 5 UTR,, 90 bp 3 UTR, Takara SYBR Premix ExTaq Applied Biosystems 7500 Real Time PCR System, 20 L, cdna 2 L, 0. 8 L( 10 mol L - 1 ), SYBR Premix ExTaq 10 L, ROX Reference Dye 0. 4 L, dh 2 O 6 L, Compute pi/ Mw s, 95 5 s, s, 40 SPSS Turkey g ,, cdna, RNA, RACE PCR g 3, ( pi) g cdna PCR GenBank, KM AATAAA Poly( A) 558 bp ORF, 185 ( 1) GWEL( goose egg white lysozyme) domain SLT( soluble lytic transglycosylase) domain 2, 3 ( Glu73 Asp86 Asp97), 4 ( Leu93 Ile121 Ile127 Gly150 ), kd,, 2. 2 g [ 19], g

44 11 Fig. 1 1 g cdna cdna sequence of g-type lysozyme gene and putative amino acid sequence in M. amblycephala g, 2. 3 g 91%, DNAMAN g 6 g, ( 3) 2 3 g ( 2) MAGE 5. 0 2,, 2 Tab.

4 44 11 Fig. 1 1 g cdna cdna sequence of g-type lysozyme gene and putative amino acid sequence in M. amblycephala g, 2. 3 g 91%, DNAMAN g 6 g, ( 3) 2 3 g ( 2) MAGE ,, 2 Tab. 2 g Comparison of similarity of g-type lysozyme nucleotide and amino acid sequence from M. amblycephala and other vertebrates species Genbank Genbank No. ( Bos Taurus) AAC ( Capra hircus) AHA ( Macaca mulatta) CAA ( Homo sapiens) AAA ( Litopenaeus vannamei) AAN ( Penaeus monodon) AGA83301 < 30 ( Macrobrachium nipponense) AAP13578 < 30 ( Scylla paramamosain) ADM ( Fenneropenaeus indicus) ACV49870 < 30 ( Portunus trituberculatus) ACM ( Azumapecten farreri) AGA ( Argopecten irradians) AAX ( Ctenopharyngodon idella) ACF ( Ictalurus furcatus) ADO ( Astyanax mexicanus) XP_ / % amino acid similiarity

5 2 : g cdna 45 Fig. 2 2 g 3 ( Glu Asp Asp) ( Leu Ile Ile Gly) Multiple sequence alignment of M. amblycephala g-type lysozyme with that from other species by DNAMAN The enzyme catalytic sites ( Glu, Asp, Asp) are shown in yellow box, and the four substrate binding sites ( Leu, Ile, Ile, Gly) are shown in red box., g, g 6 cdna PCR, ( 4), bp 2. 4 g qrt-pcr, -actin PCR -actin 6

46 11 3 MEGA 5. 0 g 1. ; 2. ; 3. ; 4. Fig. 3 Phylogenetic tree of the g-type lysozyme amino acid sequence in diffrerent groups by MEGA 5. 0 1. crustacean; 2. mammal; 3. mollusc; 4.

6 MEGA 5. 0 g 1. ; 2. ; 3. ; 4. Fig. 3 Phylogenetic tree of the g-type lysozyme amino acid sequence in diffrerent groups by MEGA crustacean; 2. mammal; 3. mollusc; 4. fish 4 g -actin 6 M. Marker DL2000 ; actin Fig. 4 ; g mrna Amplification of g-type lysozyme and -actin gene in six different tissues of M. amblycephala M. Marler DL2000; actin in intestine, liver, brain, kidney, gill and muscle of M. amblycephala; g-type lysozyme in ntestine, liver, brain, kidney, gill and muscle from M. amblycephala 5 Fig. 5 qrt-pcr g-type ( n = 3, P < 0. 05) Relative expression of g-type lysozyme mrna in different tissues of M. amblycephala by qrt-pcr Different letters indicate significant difference among different groups ( n = 3, P < 0. 05) g, 72 h 6, g 1, ( P >, g 0. 05), ( 5) 3 h ( P < 2. 5 g mrna 0. 05),, 72, 72 h PCR ( 6 - a) ; 12 ( P <

7 2 : g cdna ), h ( 6 - b), 3 ( P < 0. 05), 6 72, g, 72 h ( P <0. 05) ( 6 - c) 3 [ 20], [ 21], g cdna, kd, 3 4 [ 13] 2,, g, [ 4-6 ] g, g,,, g [ ], 6 ( a) ( b) ( c), g mrna,,, g, 2 and gill ( c) of M. amblycephala in response to : 1),, [ ] ; 2),,, s0. 0 h; s3. 3 h; s6. 6 h; s h; s h; s h; s h; r h; *. ( n = 3, P < ) Fig. 6 Expression of g-type lysozyme in liver ( a), brain ( b) ammonia-n stress and recovery s0. ammonia-n stress 0 h; s3. ammonia-n stress 3 h; s6. ammonia-n stress 6 h; s12. ammonia-n stress 12 h; s24. ammonia-n stress 24 h; s48. ammonia-n stress 48 h; s72. ammonia-n stress 72 h; r72. recovery 72 h; *. significant different compared with control ( n = 3, P < 0. 05) [ 26],,, [ 2 7], 3,

48 11 g,, 72, 72 h, g,,,, 72 h, 72 h, g [ 2 8-29 ] GSH-Px, [ 31] GSH-Px ( Acipenser schrencki),, ; [ 30 ] 509.

8 48 11 g,, 72, 72 h, g,,,, 72 h, 72 h, g [ ] GSH-Px, [ 31] GSH-Px ( Acipenser schrencki),, ; [ 30 ] 509.,,,, [ 32] ( Strongylocentrotus intermedius) ; [ 33 ] ( Crassostrea hongkongensis) [ 3 4] ; ( Car- assius auratus) g,, 43. [ 15], : 2002, 13( 5) : [ 2] PRAGER E M. Lysozymes: model enzymes biochemistry and biology[ M]. Vol. 75. Birkh user Verlag, Basel. Switzerland: Springer, 1996 : [ 3] QASBA P K, KUMAR S, BREW K. Molecular divergence of lysozymes and -lactalbumin[ J]. Crit Rev Biochem Mol Biol, 1997, 32( 4) : [ 4] NILSEN I W, MYRNES B. The gene of chlamysin, a marine invertebrate-type lysozyme, is organized similar to vertebrate but different from invertebrate chicken-type lysozyme genes [ J]. 2001, 269 ( 1) : Gene, [ 5]. : [ D]. :, [ 6] IRWIN D M, GONG Z M. Molecular evolution of vertebrate goosetype lysozyme genes[ J]. J Mol Evol, 2003, 56( 2 ) : [ 7] LARSEN A N, SOLSTAD T, SVINENG G, et al. Molecular characterization of a goose-type lysozyme gene in Atlantic cod ( Gadus morhua L. ) [ J]. Fish & Shellfish Immunol, 2009, 26( 1) : [ 8 ] KYOMUHENDO P, MYRNES B, NILSEN I W. A cold-active salmon goose-type lysozyme with high heat tolerance[ J]. Life Sci, 2007, 64( 21) : Cell Mol [ 9] YE X, ZHANG L, TIAN Y, et al. Identification and expression a- nalysis of the g-type and c-type lysozymes in grass carp Ctenopharyngodon idella [ J]. Dev Comp Immunol, 2010, 34 ( 5 ) : [ 10] HAO L, SUN J, SUN L. The g-type lysozyme of Scophthalmus maximus has a broaf substrate spectum and is involved in the immune response against bacterial infection[ J]. Fish & Shellfish Immunol, 2011, 30( 2) : [ 11 ] WANG I, LEE Y, LEE S, et al. Characterization and expression analysis of a goose-type lysozyme from the rock bream Oplegnathus fasciatus, and antimicrobial activity of its recombinant protein[ J]. Fish & Shellfish Immunol, 2011, 20 ( 2) : [ 12] SAVAN R, AMAN A, SAKAI M. Molecular cloning of g-type lysozyme cdna in commom carp( Cyprinus carpio L. ) [ J]. Shellfish Immunol, 2003, 15 ( 3) : Fish & [ 13] SUN B, WANG G, XIE H, et al. Gene structure of goose-type lysozyme in mandarin Siniperca chuatsi wirh analysis on the lytic activity of its recombinant in Escherichia coli[ J]. 2006, 252( 2 /3 /4) : Aquaculture, [ 14],. [ J]., 2011, 38( 1) : , 19 ( 4) : [ J]., [ 16 ] SUN S M, GE X P, XUAN F J, et al. Nitrite-induced hepatotoxicity in blunt snout bream ( Megalobrama amblycephala ) : mechanistic insight from transcriotome to physiology analysis[ J]. Environ Toxical Pharmacol, 2014, 37( 10) : [ 1],,. [ J]. [ 17] SUN S M, GE X P, ZHU J, et al. Identification and mrna expression of antioxidant enzyme genes associated with the oxidative the

2 : g cdna 49 stress response in the Wuchang bream ( Megalobrama amblycephala Yih) in response to acute nitrite exposure [ J]. Comp Biochem Physiol C, 2014, 159: 69-77. [ 18] RANDALL D J, TSUI T K N.

9 2 : g cdna 49 stress response in the Wuchang bream ( Megalobrama amblycephala Yih) in response to acute nitrite exposure [ J]. Comp Biochem Physiol C, 2014, 159: [ 18] RANDALL D J, TSUI T K N. Ammonia toxicity in fish[ J]. Mar Pollut Bull, 2002, 45 ( 1) : [ 19] SCHMITTGEN T D, LIVAK K J. Analyzing real-time PCR data by the comparative CT method[ J]. Nat Protocols, 2008, 3( 6 ) : [ 20] BENKERROUM N. Antimicrobial activity of lysozyme with special relevance to milk[ J]. Afr J Biochem, 2008, 7 ( 25 ) : [ 21 ] ZHAO J, SONG L, LI C, et al. Molecular cloning of an invertebrate goose-type lysozyme gene from Chlamys farreri, and lytic activity of the recombinant protein[ J]. Mol Immunol, 2007, 44 ( 6) : [ 22 ] ZANG X N, LIU B, LIU S M, et al. Transformation and expression of Paralichthys olivaceus growth hormone cdna in Synechocystis sp. PCC6803 [ J]. Aquaculture, 2007, 266 ( 1 ) : [ 23]. ( ) [ J]., 1990, 12( 2 ) : [ 24 ] MOCK A, PETERS G. Lysozyme activity in rainbow trout, Oncorhynchus mykiss ( Walbaum), sressed by handing, transport and water pollution[ J]. J Fish Biol, 1990, 37( 6) : [ 25] YIN Z, LAM T J, SIN Y M. The effects of crowding stress on the non-specific immune response in fancy carp ( Cyprinus carpio L) [ J]. Fish & Shellfish Immunol, 1995, 5( 7) : [ 26]. [ J]., 2002, 26( 4) : [ 27]. [ J]. 2005, 26( 12) : [ 28]. [ D]. :, [ 29],,. [ J]., ( 2 ) : [ 30],. [ J]., ( 3 ) : [ 31],. [ J]., ( 3) : [ 32],,. cdna [ J]., 2013, 20 ( 5 ) : [ 33],. [ J]., 2013, 9 ( 3) : [ 34],. [ J]., 2004, 11 ( 5) :

60 12 ( Pampus argenteus), [ 1 ], [ [ 2 ],, ( ) cm, ( ),, g] 1. 2,,, 50%d , ph 7. 9 [ 3 ], 0. 5, 6 8 mgl - 1, 27, 24 h [

60 12 ( Pampus argenteus), [ 1 ], [ [ 2 ],, ( ) cm, ( ),, g] 1. 2,,, 50%d , ph 7. 9 [ 3 ], 0. 5, 6 8 mgl - 1, 27, 24 h [ 12 2 2 0 1 6 4 South China Fisheries Science Vol. 12, No. 2 Apr., 2016 doi: 10. 3969/ j. issn. 2095-0780. 2016. 02. 009 1 1, 2 1 1 1,,,, ( 1.,, 200090; 2., 201306) : ( Pampus argenteus), 3 22, 27 32, 27,