Lobeglitazone Exerts Anti-Inflammatory Effect in Lipopolysaccharide-Induced Bone-Marrow Derived Macrophages

biomedices Article Lobeglitazone Exerts Anti-Inflammatory Effect Lipopolysaccharide-Induced Bone-Marrow Derived Macrophages Dab Jeong 1,2, Wan-Kyu Ko 1,3, Seong-Jun Kim 1,3, Gong-Ho Han 1,3, Daye Lee 1,3, Seung-Hun Sheen 1, * Seil Sohn 1, * 1 Department Neurosurgery, CHA Bundang Medical Center, Seongnam-si 13496, Korea; dbjekqls77@gmail.com (D.J.); wankyu@chauniv.ac.kr (W.-K.K.); ksj987456@chauniv.ac.kr (S.-J.K.); hgh429@chauniv.ac.kr (G.-H.H.); day03@chauniv.ac.kr (D.L.) 2 Department Biology, Lawrence University, Appleton, WI 54911, USA 3 Department Biomedical Science, CHA University, Seongnam-si 13493, Korea * Correspondence: nssheen@cha.ac.kr (S.-H.S.); sisohn@cha.ac.kr (S.S.) Citation: Jeong, D.; Ko, W.-K.; Kim, S.-J.; Han, G.-H.; Lee, D.; Sheen, S.-H.; Sohn, S. Lobeglitazone Exerts Anti-Inflammatory Effect Lipopolysaccharide-Induced Bone-Marrow Derived Macrophages. Biomedices 2021, 9, 1432. https:// doi.org/10.3390/biomedices9101432 Academic Editor: Alexer N. Orekhov Received: 30 August 2021 Accepted: 7 October 2021 Published: 10 October 2021 Publisher s Note: MDPI stays neutral with regard to jurisdictional claims published maps stitutional affiliations. Copyright: 2021 by the authors. Licensee MDPI, Basel, Switzerl. This article is an open access article distributed under the terms conditions the Creative Commons Attribution (CC BY) license (https:// creativecommons.org/licenses/by/ 4.0/). Abstract: The purpose this study is to elucidate the anti-flammatory effect lobeglitazone () lipopolysaccharide (LPS)-duced bone-marrow derived macrophages (BMDMs). We duced nitric oxide (NO) production pro-flammatory gene expression through LPS treatment BMDMs. The changes NO release expression pro-flammatory mediators by were assessed via NO quantification assay a real-time quantitative polymerase cha reaction (RT-qPCR), respectively. In addition, the regulatory effect on activation mitogen-activated prote kase (MAPK) signalg pathway vestigated by measurg the phosphorylation state extracellular regulatory prote (ERK) c-jun N-termal kase (JNK) protes by Western blot. Our results show that significantly reduced LPS-duced NO production proflammatory gene expression terleuk-1β (IL-1β), IL-6, ducible nitric oxide synthase (inos), cyclooxygenase-2 (COX-2), monocyte chemoattractant prote-1 (MCP-1). Moreover, reduced phosphorylation levels ERK JNK MAPK signalg pathway. In conclusion, exerts an anti-flammatory effect LPS-duced BMDMs by suppression NO production pro-flammatory gene expression, this effect is potentially through hibition the MARK signalg pathway. Keywords: bone-marrow derived macrophages; lipopolysaccharide; lobeglitazone; anti-flammation; mitogen-activated prote kase 1. Introduction Inflammation is the host s defensive response agast pathogenic fection, cellular stress, tissue jury [1], macrophages are critical players modulation flammation. They survey pathogen vasion respond to cellular stress by releasg a variety pro-flammatory mediators such as nitric oxide (NO), terleuk-1β (IL-1β), IL-6, cyclooxygenase-2 (COX-2), monocyte chemoattractant prote-1 (MCP-1) [2 7]. Upregulation macrophage flammation is characterized by aberrant crease pro-flammatory mediators. Indeed, accumulation aforementioned pro-flammatory molecules is implicated pathogenesis autoimmune flammatory diseases such as type 2 diabetes, atherosclerosis, spal cord jury [8 10]. Current pharmaceutical terventions cludg use corticosteroid non-steroidal anti-flammatory drugs (NSAIDs) are commonly practiced for managg flammation [11,12]. However, f-target events adverse side effects current anti-flammatory drug imply unmet dem for identification a new drug with potential anti-flammatory properties [13]. Biomedices 2021, 9, 1432. https://doi.org/10.3390/biomedices9101432 https://www.mdpi.com/journal/biomedices

Biomedices 2021, 9, 1432 2 10 Lobeglitazone () is a potential peroxisome-proliferator-activated receptor α/γ (PPARα/γ) agonist a newly developed synthetic thiazolidedione (TZD) class drug for restoration sul sensitivity type 2 diabetes patients [14]. Although primary function TZDs is anti-diabetic, TZDs are also reported to possess anti-flammatory effects [15]., an emergg TZD, is extensively studied for its anti-diabetic effects both pre-clical clical trials [16 19]. However, its anti-flammatory assessment limited to adipose tissue human umbilical ve endothelial cells (HUVECs), leavg regulatory effect on macrophage flammation not elucidated [18,20]. The purpose the present study is to exame anti-flammatory action macrophage flammation. We employed rat bone-marrow derived macrophages (BMDMs). Lipopolysaccharide (LPS) used as a stimulant to duce flammation macrophages vitro [21,22]. In this study, the effect on expression proflammatory mediators mitogen-activated prote kase (MAPK) pathway were evaluated. Our results demonstrate that down-regulated key pro-flammatory mediators at transcription level, potentially through hibition extracellular regulatory prote (ERK) c-jun N-termal kase (JNK) signalg MAPK pathway. These fdgs can provide sight to the pharmacological role macrophage flammation, its potential applications a variety flammatory diseases. 2. Materials Methods 2.1. Preparation LPS The sulfate obtaed from Chong Kun Dang pharmaceutical corp. (Seoul, Korea). It dissolved dimethyl sulfoxide (DMSO, Thermo Scientific, Waltham, MA, USA) stored at room temperature the absence light. For vitro assays, sulfate solubilized Dulbecco s Modified Eagle s Medium (DMEM, Gibco, Waltham, MA, USA) contag 10% fetal bove serum (FBS, Gibco) 1% penicill-streptomyc (PS, Gibco). LPS purchased from Sigma-Aldrich (Sigma, St. Louis, MI, USA) diluted with distilled water (100 µg/ml). For subsequent experiments, it diluted with DMEM media to a fal concentration 0.1 µg/ml LPS to duce an flammatory response BMDMs. 2.2. Experimental Group The differences six groups were compared: a group without any treatment BMDMs (control group), a group only with treatment (200 µm group), a group only with LPS treatment (LPS group), a group with LPS treatment together with dicated concentrations (LPS + 50 µm, LPS + 100 µm, LPS + 200 µm group). 2.3. Cell Culture BMDMs were cultured DMEM contag 10% FBS, 1% PS, 10 ng/ml macrophage colony-stimulatg factor (M-CSF) (Peprotech, Rocky Hill, NJ, USA) at 37 C a 5% CO 2 atmosphere, the culture media changed once 2 days. 2.4. BMDM Preparation The preparation procedures BMDMs were followed as described elsewhere [21,23,24]. First, bone-marrow monocyte (BMM) progenitor cells were extracted from pairs tibia femur Sprague Dawley rats at 4 weeks age. The ner cavities the tibia femur were rsed with DMEM media supplemented with 10% FBS 1% PS. The flushed media passed through 70 µm cell filter. The cell suspension contag BMMs centrifuged, the resultg cell pellet subjected to Red Blood Cell lysis buffer (Sigma) for 30 s. The pellet resuspended with fresh media cultivated for 4 h to selectively collect suspendg BMMs from adherent population cells. The BMMs were then stimulated with M-CSF (10 ng/ml) to yield BMDMs. On day 3, additional 10 ml DMEM media supplemented with 30 ng/ml M-CSF added to enhance

Biomedices 2021, 9, 1432 3 10 BMDM differentiation, the cells were cultured for another four days. On day 7, the differentiated BMDMs were used further experiments. 2.5. Cell Cytotoxicity Test The procedures were followed as described previously [21]. The cell viability various concentrations (0, 1, 5, 10, 50, 100, 200, 500 µm) evaluated usg a cell viability kit (EZ-Cytox, Daeil Labservice, Seoul, Korea). BMDM cells were seeded on 96 well culture plate (Falcon Becton Dickson, Lcoln Park, NJ, USA, 4 10 4 cells/well, n = 3 per group) treated with dicated concentrations for 24 h. At 24 h, 10-fold diluted EZ-Cytox solution added to react for 1 h. The supernatant assessed at 450 nm usg a microplate reader (Bio-Rad, Hercules, CA, USA). The cell viability groups calculated as relative % normalized to control group by settg control group as 100% viability. 2.6. NO Quantification NO quantification performed as described our previous paper [21]. BMDMs were seeded on 6 well culture plate (Falcon, 5 10 5 cells/well, n = 3 per group) treated with 50 µm, 100 µm, 200 µm LPS for 24 h. At 24 h, supernatants were collected, NO quantified by usg a Griess Reagent Kit (Thermo). 2.7. RT-qPCR RT-qPCR procedures were followed as described previously [25]. BMDMs were seeded on 6 well culture plate (Falcon, 5 10 5 cells/well, n = 3 per group) treated with or without LPS stimulation for 4 h. The total RNA BMDMs isolated, a complementary sequence the extracted RNA synthesized to make a cdna template. Pair primer sequences designed to amplify target gene products (Table 1). The RT-qPCR reaction performed usg an ABI Step One Real-time PCR System (Applied Biosystems, Warrgton, UK). The RT-qPCR run at the followg conditions: 40 cycles denaturation at 95 C for 15 s, followed by 60 C for 30 s to allow for extension amplification the target sequence. The relative expression levels target genes were normalized to glyceraldehyde 3-phosphate dehydrogenase (GAPDH) usg 2 C T method [26]. Table 1. Nucleotide sequences primers used RT-qPCR. Gene Forward (5 3 ) Reverse (5 3 ) IL-1β CCCTGCAGCTGGAGAGTGTGG TGTGCTCTGCTTCAGAGGTGCT IL-6 TTGTTGCTGTGGAGAAGCTGT AACGTCACACACCAGCAGGTT inos CGGAGGAGAAGTGGGGTTTAGGAT TGGGAGGCACTTGCGTTGATGG COX-2 GACCAGATAAGGGCAAGCAC CTTGTCTTTGACCCAGTAGC MCP-1 ATGATTCTACCCACGGCAAG CTGGAAGATGGTGATGGGTT GAPDH ATGATTCTACCCACGGCAAG CTGGAAGATGGTGATGGGTT 2.8. Western Blot The detailed procedures for Western blot are described our previous work [27]. BMDMs were seeded on 6 well culture plate (Falcon, 1 10 6 cells/well, n = 3 per group) treated with dicated concentrations LPS for 24 h. At 24 h, the total protes were extracted usg ice-cold RIPA lysis buffer with protease hibitor (Roche Applied Science, Indianapolis, IN, USA) phosphatase hibitor cocktails (Sigma). The concentrations isolated protes were quantified usg BCA assay kit (Thermo). Then, 20 µg prote samples equal volume subjected to 10% sodium dodecyl sulphate-polyacrylamide (SDS-PAGE) gel electrophoresis transferred to nitrocellulose transfer membranes (Protran, Whatman, Buckghamshire, UK). Then, 5% bove serum album (BSA) blockg solution used to block membranes for 1 h. Primary antibodies phosphorylated forms ERK (p-erk) (1:1000) JNK (p-jnk) (1:1000)

transfer membranes (Protran, Whatman, Buckghamshire, UK). Then, 5% bove serum album (BSA) blockg solution used to block membranes for 1 h. Primary antibodies phosphorylated forms ERK (p-erk) (1:1000) JNK (p-jnk) (1:1000) were 4 10 Biomedices 2021, 9, 1432 cubated overnight then treated with anti-rabbit secondary antibody (1:5000, Gene Tex International Corporation, Hschu, Taiwan, Cha). The same membranes were reprobed were cubated with total overnight forms ERK then (t-erk) treated (1:1000) with anti-rabbit JNK (t-jnk) secondary (1:1000) antibody after strippg (1:5000, antibodies. Gene Tex International The membrane Corporation, bs were Hschu, developed Taiwan, usg horseradish Cha). Theperoxidase same membranes (Amersham were re-probed ECL, Buckghamshire, with total forms UK) ERK through (t-erk) a (1:1000) G: Box Chemi-XX6 JNK (t-jnk) gel (1:1000) doc system after (Syngene, strippg Frederick, antibodies. MD, TheUSA). membrane All primary bs were antibodies developed were usg purchased horseradish from Cell peroxidase Signalg (Amersham Technology ECL, (Danvers, Buckghamshire, MA, USA). The UK) b through tensities a G: Box for Chemi-XX6 phosphorylated gel doc system total forms (Syngene, were Frederick, quantified MD, usg USA). ImageJ All primary by National antibodies Institute were purchased Health (NIH, frombethesda, Cell Signalg MD, USA). Technology Total forms (Danvers, were MA, used USA). as an The ternal b tensities control to normalize for phosphorylated phosphorylation totallevels. forms ERK were quantified JNK phosphorylation usg ImageJ by were National compared Institute between Health groups (NIH, by settg Bethesda, p/t volume MD, USA). LPS Total group formsas were 1-fold. used as an ternal control to normalize phosphorylation levels. ERK JNK phosphorylation were compared between groups by settg p/t volume LPS group 2.9. as 1-fold. Statistical Analysis All values were presented as the mean ± stard deviation (SD). A one-way analysis 2.9. variance Statistical (ANOVA) Analysisfollowed by post hoc test (Tukey s test) used to compare verify All statistical values were differences presented among as the the mean groups. ± stard Differences deviation p-values (SD). for A one-way which * p analysis < 0.05, ** p variance < 0.01, (ANOVA) *** p < 0.001 followed were considered by post hocto test be (Tukey s statistically test) significant. used to compare verify statistical differences among the groups. Differences p-values for which * p < 0.05, 3. ** Results p < 0.01, *** p < 0.001 were considered to be statistically significant. 3.1. Molecular Structure Cytotoxicity on BMDMs 3. Results 3.1. Figure Molecular 1 demonstrates Structure the molecular Cytotoxicity structure. on BMDMs To exclude the possibility a drug cytotoxicity affectg vestigation the anti-flammatory effect, the cytotoxicity Figure 1 demonstrates the molecular structure. To exclude the possibility a evaluated. doses rangg from 1 µm to 200 µm did not significantly drug cytotoxicity affectg vestigation the anti-flammatory effect, the cytotoxicity crease nor decrease cell viability (Figure 2, control: 100% ± 4.09, control vs. 1 µm: evaluated. doses rangg from 1 µm to 200 µm did not significantly 110.35% ± 9.92, 5 µm: 108.19% ± 4.36, 10 µm: 111.35% ± 4.48, 50 µm: crease nor decrease cell viability (Figure 2, control: 100% ± 4.09, control vs. 118.48% 1 µm: 110.35% ± 7.24, ± 9.92, 100 µm: 123.4% 5 µm: 108.19% ± 4.73, ± 4.36, 200 µm: 115.36% 10 µm: 111.35% ± 9.74, not ± significant: 4.48, n.s.). 50 µm: However, 118.48% a ± significant 7.24, decle 100 µm: 123.4% observed ± 4.73, 500 µm 200 µm: 115.36% (Control ± vs. 9.74, not 500 significant: µm: 100% n.s.). ± 4.09 However, vs. 46.86% a significant ± 0.62, *** decle p < 0.001). Three observed concentrations 500 µm 50 µm, 100 (Control µm, vs. 200 µm 500 µm: 100% were ± selected 4.09 vs. 46.86% used ± subsequent 0.62, *** p < experiments. 0.001). Three concentrations 50 µm, 100 µm, 200 µm were selected used subsequent experiments. Figure 1. The molecular structure lobeglitazone (). Figure 1. The molecular structure lobeglitazone ().

Biomedices 2021, 9, 1432 5 10 Biomedices 2021, 9, x FOR PEER REVIEW 5 10 Figure Figure 2. Cytotoxic 2. Cytotoxic effect on bone-marrow effect bone-marrow derived macrophages derived (BMDMs) macrophages by. (BMDMs) were by. BMDMs were treated with pre-determed concentrations (0, 1, 5, 10, 50, 100, 200, 500 µm) for 24 h. treated with pre-determed concentrations (0, 1, 5, 10, 50, 100, 200, 500 µm) for 24 h. Adherent or livg cells were counted usg cell viability kit normalized to control group as 100%. Adherent Results are or the livg mean ± stard cells were deviation counted (SD) usg triplicate cell experiments: viabilitynot kitsignificant normalized (n.s.), to control group as *** p 100%. < 0.001, Results significant are difference the mean as compared ± stard to the deviation control group (SD) each triplicate group by experiments: a one-way not significant (n.s.), analysis variance (ANOVA) followed by Tukey s post hoc analysis. *** p < 0.001, significant difference as compared to the control group each group by a one-way 3.2. analysis Inhibitory Effect variance NO Production (ANOVA) by followed by Tukey s post hoc analysis. To assess whether hibit NO production, we quantified NO production LPS-stimulated 3.2. Inhibitory BMDMs Effect compared NO Production its changes byafter treatment. We first confirmed that alone did not duce any significant creases NO production (Figure 3, control vs. 200 µm: 1.77 µm ± 0.13 vs. 3.60 µm ± 0.14, n.s.). In the LPS group, a significant crease NO production observed compared to the control group (Figure 3, control vs. LPS: 1.77 µm ± 0.13 vs. 72.36 µm ± 1.98, *** p < 0.001). This surge NO significantly decreased treatment groups a dose-dependent manner (Figure 3, LPS vs. LPS + 50 µm: 72.36 µm ± 1.98 vs. 64.60 µm ± 2.03, LPS + 50 µm vs. LPS + 100 µm: 64.60 µm ± 2.03 vs. 56.3 µm ± 1.47, LPS + 100 µm vs. LPS + 200 µm: 56.3 µm ± 1.47 vs. 13.23 µm ± 0.34, *** p < 0.001). To assess whether hibit NO production, we quantified NO production LPSstimulated BMDMs compared its changes after treatment. We first confirmed that alone did not duce any significant creases NO production (Figure 3, control vs. 200 µm: 1.77 µm ± 0.13 vs. 3.60 µm ± 0.14, n.s.). In the LPS group, a significant crease NO production observed compared to the control group (Figure 3, control vs. LPS: 1.77 µm ± 0.13 vs. 72.36 µm ± 1.98, *** p < 0.001). This surge NO significantly decreased treatment groups a dose-dependent manner (Figure 3, LPS vs. LPS + 50 µm: 72.36 µm ± 1.98 vs. 64.60 µm ± 2.03, LPS + Biomedices 2021, 9, x FOR PEER REVIEW 50 µm vs. LPS + 100 µm: 64.60 µm ± 2.03 vs. 56.3 µm ± 6 1.47, 10 LPS + 100 µm vs. LPS + 200 µm: 56.3 µm ± 1.47 vs. 13.23 µm ± 0.34, *** p < 0.001). Figure Figure 3. Inhibition 3. Inhibition nitric oxide nitric (NO) oxide production (NO) by production lipopolysaccharide by lipopolysaccharide (LPS)-stimulated BMDMs. BMDMs were pre-treated with or without for 20 m, followed by stimulation (LPS)-stimulated or not BMDMs. with 0.1 µg/ml BMDMs LPS were for 24 pre-treated h. After 24 h, with the NO-contag or without supernatant for 20 from m, each followed group by stimulation or not with collected 0.1 to µg/ml quantify NO LPS concentrations. for 24 h. Results After 24 are h, the the mean NO-contag ± SD triplicate experiments: supernatant from each group n.s, *** p < 0.001, significant difference as compared to the control group each group by a oneway ANOVA followed by Tukey s post hoc analysis. collected to quantify NO concentrations. Results are the mean ± SD triplicate experiments: n.s., *** p < 0.001, significant difference as compared to the control group each group by a one-way 3.3. ANOVA Decreased followed Pro-Inflammatory by Tukey sgene postexpressions hoc analysis. LPS-Induced BMDMs. Next, we examed regulatory effect on expression pro-flammatory cytokes chemokes by measurg gene expression levels through RT-qPCR. itself did not duce pro-flammatory gene expression (Figure 4, IL-1β, 200 µm: 1.24 ± 0.068; IL-6, 200 µm: 0.01 ± 0.070; inos, 200 µm: 2.12 ± 0.85; COX-2, 200 µm: 0.83 ± 0.17; MCP-1, 200 µm: 0.47 ± 0.02, n.s.). Remarkably, LPS-duced expression levels pro-flammatory genes IL-1β, IL-6, inos, COX-2, MCP-

Biomedices 2021, 9, 1432 6 10 3.3. Decreased Pro-Inflammatory Gene Expressions LPS-Induced BMDMs Next, we examed regulatory effect on expression pro-flammatory cytokes chemokes by measurg gene expression levels through RT-qPCR. itself did not duce pro-flammatory gene expression (Figure 4, IL-1β, 200 µm: 1.24 ± 0.068; IL-6, 200 µm: 0.01 ± 0.070; inos, 200 µm: 2.12 ± 0.85; COX-2, 200 µm: 0.83 ± 0.17; MCP-1, 200 µm: 0.47 ± 0.02, n.s.). Remarkably, LPSduced expression levels pro-flammatory genes IL-1β, IL-6, inos, COX-2, MCP-1 were significantly reduced all groups compared to that LPS group, the decrease the most evident 200 µm (LPS + 200 µm: 260.04 ± 15.76, 780.43 ± 104.41, 293.94 ± 10.43, 325.19 ± 24.28, 8.38 ± 0.02, respectively, *** p < 0.001). Still, 50 µm sufficient to duce significant reduction pro-flammatory mrna expression IL-1β, IL-6, inos, COX-2, MCP-1. (LPS + 50 µm 599.11 ± 16.90, ** p < 0.01, 1585.64 ± 159.39, 328.33 ± 8.73, 477.44 ± 47.10, 48.267 ± 1.69, *** p < 0.001, respectively). Biomedices 2021, 9, x FOR PEER REVIEW 7 10 Figure 4. 4. mediated down-regulation gene gene expression expression key pro-flammatory key pro-flammatory molecules molecules LPS-duced LPS-duced BMDMs. The BMDMs. BMDMs The were BMDMs pre-treated were pre-treated with or without or without for 20 m, for 20 m, then stimulated then stimulated or not with or not 0.1 µg/ml with 0.1 µg/ml LPS for LPS 24 h. for The24 cells h. The werecells thenwere subjected then to subjected real-timeto quantitative real-time quantitative polymerase polymerase cha reaction cha (RT-qPCR) reaction analysis (RT-qPCR) to detect analysis mrna to detect expression mrna levels expression proflammatory levels proflammatory mediators (A) mediators terleuk-1β (A) terleuk-1β (IL-1β) (B) IL-6, (IL-1β) (C) (B) ducible IL-6, (C) nitric ducible oxide nitric synthase oxide (inos), synthase (D) (inos), cyclooxygenase-2 (D) cyclooxygenase-2 (COX-2), (COX-2), (E) monocyte (E) monocyte chemoattractant chemoattractant prote-1 (MCP-1). prote-1 The (MCP-1). mrnathe expressions mrna expressions target genes target were normalized genes were to normalized glyceraldehyde to glyceraldehyde 3-phosphate 3-phosphate dehydrogenase dehydrogenase (GAPDH) mrna. (GAPDH) The mrna. expression The level expression level control for all dicated genes set at 1-fold, relative fold change calculated. Results are the mean control for all dicated genes set at 1-fold, relative fold change calculated. Results are the mean ± SD ± SD triplicate experiments: n.s., ** p < 0.01, *** p < 0.001, significant difference as compared to the control group triplicate experiments: n.s., ** p < 0.01, *** p < 0.001, significant difference as compared to the control group each group each group by a one-way ANOVA followed by Tukey s post hoc analysis. by a one-way ANOVA followed by Tukey s post hoc analysis. 3.4. Acts through MAPK Signalg Pathway by Decreasg Phosphorylation ERK 3.4. Acts through MAPK Signalg Pathway by Decreasg Phosphorylation ERK JNK Signalg JNK Signalg To test whether affect MAPK signalg pathway, phosphorylation state ERK To test whether affect MAPK signalg pathway, phosphorylation state ERK JNK JNK MAPK MAPK signalg signalg quantified quantified compared. compared. The The phosphorylated phosphorylated form form ERK ERK JNK JNK significantly significantly expressed expressed LPS LPS group group relative relative to to that that control control group group (Figure (Figure 5A). 5A). In In the the LPS LPS + 50 50 µm µm group, group, fold fold changes changes phosphorylation phosphorylation state state ERK ERK JNK did not reach statistical significance when compared to the LPS group (Figure 5B C, ERK, LPS vs. LPS + 50 µm: 1 ± 0 vs. 1.07 ± 0.033, JNK, LPS vs. LPS + 50 µm: 1 ± 0 vs. 0.96 ± 0.028, n.s.). However, a significant decrease phosphorylation level ERK JNK observed the 200 µm group compared to that the LPS group (ERK, LPS vs. LPS + 200 µm: 1 ± 0 vs. 0.48 ± 0.053, JNK, LPS vs. LPS + 200

Biomedices 2021, 9, 1432 7 10 JNK did not reach statistical significance when compared to the LPS group (Figure 5B C, ERK, LPS vs. LPS + 50 µm: 1 ± 0 vs. 1.07 ± 0.033, JNK, LPS vs. LPS + 50 µm: 1 ± 0 vs. 0.96 ± 0.028, n.s.). However, a significant decrease phosphorylation level ERK JNK observed the 200 µm group compared to that the LPS group (ERK, LPS vs. LPS + 200 µm: 1 ± 0 vs. 0.48 ± 0.053, JNK, LPS vs. LPS + 200 µm: 1 ± 0 vs. 0.40 ± 0.028, ** p < 0.01). Biomedices 2021, 9, x FOR PEER REVIEW 8 10 Figure 5. Effect on phosphorylation level extracellular regulatory kase (ERK) (A,B) c-jun N termal kase (JNK) (A,C) C) mitogen-activated prote kase (MAPK) signalg pathway LPS-stimulated BMDMs. BMDMs were pre-treated with or or without for for 20 20 m prior to to 0.1 0.1 µg/ml LPS treatment. After LPS stimulation, cells were harvested for for Western Western blot blot analysis analysis to to detect detect changes changes phosphorylation ERK ERK JNK JNK signalg. signalg. The The ratio ratio b b tensity phosphorylated form over total form quantified. The p/t volume for LPS group set to 1-fold, fold tensity phosphorylated form over total form quantified. The p/t volume for LPS group set to 1-fold, changes were calculated relative to LPS group. Results are the mean ± SD triplicate experiments: n.s., ** p < 0.01, *** p < fold changes were calculated relative to LPS group. Results are the mean ± SD triplicate experiments: n.s., ** p < 0.01, 0.001, significant difference as compared to the control group each group by one-way ANOVA followed by Tukey s *** post p < hoc 0.001, analysis. significant difference as compared to the control group each group by one-way ANOVA followed by Tukey s post hoc analysis. 4. Discussion 4. Discussion In this study, we tested anti-flammatory effect a TZD class drug,, LPSstimulated In this BMDMs. study, we We tested demonstrate anti-flammatory its effect effect on key pro-flammatory a TZD class drug, mediators,, LPSstimulated BMDMs. We demonstrate its effect on key pro-flammatory mediators, potential signalg pathways affected. potential signalg pathways affected. We first asked whether hibit release NO activated macrophages. NO We first asked whether hibit release NO activated macrophages. NO production is hallmark macrophage flammation. Although NO is beneficial at moderate physiological concentration, sustaed creased level NO accumulates reactive production is a hallmark macrophage flammation. Although NO is beneficial at moderate physiological concentration, sustaed creased level NO accumulates reactive oxygen species (ROS) brgs about upregulation various pro-flammatory gene oxygen species (ROS) brgs about upregulation various pro-flammatory gene expression nearby cells. NO is produced by a number distct sets NO synthases expression nearby cells. NO is produced by a number distct sets NO synthases macrophages, which expression inos is notable the context flammation macrophages, which expression inos is notable the context flammation [2]. [2]. Aberrant inos NO production are implicated atherosclerosis multiple Aberrant inos NO production are implicated atherosclerosis multiple sclerosis [28,29]. In our study, significantly hibited LPS-duced NO production sclerosis [28,29]. In our study, significantly hibited LPS-duced NO production expression inos. This fdg may suggest its potential antagonistic role inos expression inos. This fdg may suggest its potential antagonistic role inos NO NO secretion secretion therapeutic therapeutic potential potential diseases diseases characterized characterized by by inos inos NO NO production. production. Sce biological activities NO clude enhanced release pro-flammatory cytokes, we hypothesized can also regulate the expression pro-flammatory cytokes chemokes. Our results show major pro-flammatory effectors cludg IL- 1β, IL-6, inos, COX-2, MCP-1 were down-regulated by treatment. Previous research reported enhanced expression IL-1 β IL-6 autoimmune ischemic diseases [3,4]. Elevated COX-2 expression is implicated flammatory diseases, its blockade is representative target NSAID drugs [30,31]. Aberrant MCP-1 expression is a

Biomedices 2021, 9, 1432 8 10 Sce biological activities NO clude enhanced release pro-flammatory cytokes, we hypothesized can also regulate the expression pro-flammatory cytokes chemokes. Our results show major pro-flammatory effectors cludg IL-1β, IL-6, inos, COX-2, MCP-1 were down-regulated by treatment. Previous research reported enhanced expression IL-1 β IL-6 autoimmune ischemic diseases [3,4]. Elevated COX-2 expression is implicated flammatory diseases, its blockade is representative target NSAID drugs [30,31]. Aberrant MCP-1 expression is a molecular marker type 2 diabetes other flammatory diseases [6]. We present that hibited pro-flammatory gene expressions macrophage, this fdg may propose potential repositiong for flammatory diseases. To ga sight to the anti-flammatory effect, we further examed the effect on phosphorylation activities two major MAPK protes, ERK JNK. Activation MAPK pathways is volved multiple cellular functions cludg flammation by ducg transcription multiple pro-flammatory genes [32]. decreased ERK JNK activation, this result may expla the mechanism underlyg suppression pro-flammatory gene expression. A limitation this study should be noted. Cytotoxicity different organs needs to be demonstrated. Therefore, further vivo study is needed to correlate with the proposed anti-flammatory effect. Nonetheless, to the best our knowledge, the present study firstly demonstrates the regulatory effect a new TZD class,, on pro-flammatory mediators activated macrophages. We demonstrate that hibited major cytokes immune mediators through MAPK signalg pathway. The current study can propose the possibility as a new anti-flammatory agent patients flammatory diseases. 5. Conclusions hibited NO production major pro-flammatory gene expressions LPSstimulated BMDMs. This anti-flammatory effect is achieved possibly via hibition ERK MAPK signalg pathway. Based on our results, we suggest potential application flammatory diseases. Author Contributions: Conceptualization, D.J.; data curation, S.-J.K.; formal analysis, G.-H.H.; fundg acquisition, S.S.; vestigation, D.J. W.-K.K.; methodology, W.-K.K.; project admistration, S.-H.S. S.S.; resources, S.-H.S.; supervision, S.-H.S. S.S.; validation, G.-H.H. D.L.; writg origal draft, D.J., W.-K.K. S.-J.K.; writg review editg, S.S. All authors have read agreed to the published version the manuscript. Fundg: This work supported by the Basic Science Research Program through the National Research Foundation Korea (NRF), funded by the Mistry Science ICT (NRF-2020R1F1A1069875 by the Basic Science Research Program through NRF, funded by the Mistry Education (NRF- 2021R1A6A3A13039427). Institutional Review Board Statement: The study conducted accordg to the guideles the Institutional Animal Care Use Committee CHA University (protocol code 200119, 14 December 2020) the Guide for the Care Use Laboratory Animals (National Institutes Health (NIH), Bethesda, MD, USA). Informed Consent Statement: Not applicable. Data Availability Statement: The data presented this study are freely available on request from the correspondg author. Conflicts Interest: The authors declare no conflict terest.

Biomedices 2021, 9, 1432 9 10 References 1. Medzhitov, R. Orig physiological roles flammation. Nature 2008, 454, 428 435. [CrossRef] 2. MacMickg, J.; Xie, Q.W.; Nathan, C. Nitric oxide macrophage function. Annu. Rev. Immunol. 1997, 15, 323 350. [CrossRef] 3. Darello, C.A. Biologic basis for terleuk-1 disease. Blood 1996, 87, 2095 2147. [CrossRef] [PubMed] 4. Tanaka, T.; Narazaki, M.; Kishimoto, T. IL-6 flammation, immunity, disease. Cold Sprg Harb. Perspect. Biol. 2014, 6, a016295. [CrossRef] [PubMed] 5. Giroux, M.; Descoteaux, A. Cyclooxygenase-2 expression macrophages: Modulation by prote kase C-alpha. J. Immunol. 2000, 165, 3985 3991. [CrossRef] [PubMed] 6. Deshmane, S.L.; Kremlev, S.; Ami, S.; Sawaya, B.E. Monocyte chemoattractant prote-1 (MCP-1): An overview. J. Interferon Cytoke Res. 2009, 29, 313 326. [CrossRef] 7. Kushner, I. Regulation the acute phase response by cytokes. Perspect. Biol. Med. 1993, 36, 611 622. [CrossRef] 8. Ehses, J.A.; Perren, A.; Eppler, E.; Ribaux, P.; Pospisilik, J.A.; Maor-Cahn, R.; Gueripel, X.; Ellgsgaard, H.; Schneider, M.K.; Biollaz, G.; et al. Increased number islet-associated macrophages type 2 diabetes. Diabetes 2007, 56, 2356 2370. [CrossRef] 9. Hansson, G.K.; Hermansson, A. The immune system atherosclerosis. Nat. Immunol. 2011, 12, 204 212. [CrossRef] 10. David, S.; Kroner, A. Repertoire microglial macrophage responses after spal cord jury. Nat. Rev. Neurosci. 2011, 12, 388 399. [CrossRef] 11. Wyss-Coray, T.; Mucke, L. Ibupren, flammation Alzheimer disease. Nat. Med. 2000, 6, 973 974. [CrossRef] 12. Kle, A.; Eliakim, R. Non Steroidal Anti-Inflammatory Drugs Inflammatory Bowel Disease. Pharmaceuticals 2010, 3, 1084 1092. [CrossRef] 13. Rudmann, D.G. On-target f-target-based toxicologic effects. Toxicol. Pathol. 2013, 41, 310 314. [CrossRef] 14. Bae, J.; Park, T.; Kim, H.; Lee, M.; Cha, B.S. Lobeglitazone: A Novel Thiazolidedione for the Management Type 2 Diabetes Mellitus. Diabetes Metab. J. 2021, 45, 326 336. [CrossRef] [PubMed] 15. Yki-Jarven, H. Thiazolidediones. N. Engl. J. Med. 2004, 351, 1106 1118. [CrossRef] [PubMed] 16. Choi, B.H.; J, Z.; Yi, C.O.; Oh, J.; Jeong, E.A.; Lee, J.Y.; Park, K.A.; Kim, K.E.; Lee, J.E.; Kim, H.J.; et al. Effects lobeglitazone on sul resistance hepatic steatosis high-fat diet-fed mice. PLoS ONE 2018, 13, e0200336. [CrossRef] [PubMed] 17. J, S.M.; Park, C.Y.; Cho, Y.M.; Ku, B.J.; Ahn, C.W.; Cha, B.S.; M, K.W.; Sung, Y.A.; Baik, S.H.; Lee, K.W.; et al. Lobeglitazone pioglitazone as add-ons to metform for patients with type 2 diabetes: A 24-week, multicentre, romized, double-bld, parallel-group, active-controlled, phase III clical trial with a 28-week extension. Diabetes Obes. Metab. 2015, 17, 599 602. [CrossRef] [PubMed] 18. Kim, G.; Lee, Y.H.; Yun, M.R.; Lee, J.Y.; Sh, E.G.; Lee, B.W.; Kang, E.S.; Cha, B.S. Effects lobeglitazone, a novel thiazolidedione, on adipose tissue remodelg brown beige adipose tissue development db/db mice. Int. J. Obes. 2018, 42, 542 551. [CrossRef] 19. Kim, S.G.; Kim, D.M.; Woo, J.T.; Jang, H.C.; Chung, C.H.; Ko, K.S.; Park, J.H.; Park, Y.S.; Kim, S.J.; Choi, D.S. Efficacy safety lobeglitazone monotherapy patients with type 2 diabetes mellitus over 24-weeks: A multicenter, romized, double-bld, parallel-group, placebo controlled trial. PLoS ONE 2014, 9, e92843. [CrossRef] 20. Lim, S.; Lee, K.S.; Lee, J.E.; Park, H.S.; Kim, K.M.; Moon, J.H.; Choi, S.H.; Park, K.S.; Kim, Y.B.; Jang, H.C. Effect a new PPAR-gamma agonist, lobeglitazone, on neotimal formation after balloon jury rats the development atherosclerosis. Atherosclerosis 2015, 243, 107 119. [CrossRef] 21. Kim, S.J.; Ko, W.K.; Jo, M.J.; Arai, Y.; Choi, H.; Kumar, H.; Han, I.B.; Sohn, S. Anti-flammatory effect Tauroursodeoxycholic acid RAW 264.7 macrophages, Bone marrow-derived macrophages, BV2 microglial cells, spal cord jury. Sci. Rep. 2018, 8, 3176. [CrossRef] 22. Ko, W.K.; Lee, S.H.; Kim, S.J.; Jo, M.J.; Kumar, H.; Han, I.B.; Sohn, S. Anti-flammatory effects ursodeoxycholic acid by lipopolysaccharide-stimulated flammatory responses RAW 264.7 macrophages. PLoS ONE 2017, 12, e0180673. [CrossRef] 23. Weischenfeldt, J.; Porse, B. Bone Marrow-Derived Macrophages (BMM): Isolation Applications. Cold Sprg Harb. Protoc. 2008, 2008, pdb prot5080. [CrossRef] 24. Toda, G.; Yamauchi, T.; Kadowaki, T.; Ueki, K. Preparation culture bone marrow-derived macrophages from mice for functional analysis. STAR Protoc. 2021, 2, 100246. [CrossRef] 25. Lee, D.; Ko, W.K.; Kim, S.J.; Han, I.B.; Hong, J.B.; Sheen, S.H.; Sohn, S. Inhibitory Effects Gold Silver Nanoparticles on the Differentiation to Osteoclasts In Vitro. Pharmaceutics 2021, 13, 462. [CrossRef] 26. Schmittgen, T.D.; Livak, K.J. Analyzg real-time PCR data by the comparative C(T) method. Nat. Protoc. 2008, 3, 1101 1108. [CrossRef] 27. Han, G.H.; Kim, S.J.; Ko, W.K.; Lee, D.; Lee, J.S.; Nah, H.; Han, I.B.; Sohn, S. Injectable Hydrogel Contag Tauroursodeoxycholic Acid for Anti-neuroflammatory Therapy After Spal Cord Injury Rats. Mol. Neurobiol. 2020, 57, 4007 4017. [CrossRef] 28. Bagasra, O.; Michaels, F.H.; Zheng, Y.M.; Bobroski, L.E.; Spits, S.V.; Fu, Z.F.; Tawadros, R.; Koprowski, H. Activation the ducible form nitric oxide synthase the bras patients with multiple sclerosis. Proc. Natl. Acad. Sci. USA 1995, 92, 12041 12045. [CrossRef] [PubMed]

Biomedices 2021, 9, 1432 10 10 29. Kuhlencordt, P.J.; Chen, J.; Han, F.; Astern, J.; Huang, P.L. Genetic deficiency ducible nitric oxide synthase reduces atherosclerosis lowers plasma lipid peroxides apolipoprote E-knockout mice. Circulation 2001, 103, 3099 3104. [CrossRef] [PubMed] 30. Vane, J.R. Inhibition prostagl synthesis as a mechanism action for aspir-like drugs. Nat. New Biol. 1971, 231, 232 235. [CrossRef] [PubMed] 31. Mghetti, L. Cyclooxygenase-2 (COX-2) flammatory degenerative bra diseases. J. Neuropathol. Exp. Neurol. 2004, 63, 901 910. [CrossRef] [PubMed] 32. Kyriakis, J.M.; Avruch, J. Mammalian mitogen-activated prote kase signal transduction pathways activated by stress flammation. Physiol. Rev. 2001, 81, 807 869. [CrossRef] [PubMed]