6,: 1451,,,,,,,,, [2],,,, , 13,,, g 90 ml 20 min, 5 ml 30mL ACCC55 [3] ( 10 g K 2 HPO 4 3H 2 O 015 g NaCl 012 g CaCO 3 1 g Mg

Size: px

Start display at page:

Download "6,: 1451,,,,,,,,, [2],,,, , 13,,, g 90 ml 20 min, 5 ml 30mL ACCC55 [3] ( 10 g K 2 HPO 4 3H 2 O 015 g NaCl 012 g CaCO 3 1 g Mg"

沈闹从
6 years ago
Views:

1 2009,15(6) : Plant Nutrition and Fertilizer Science,,,,,, (; ) : S rdna, 24 66,,,65, 36 %; 52, 29 %; 19, 11 %; 3 76 %, : ; ; ; : S : A : X(2009) Collection and investigation on asymbiotic nitrogen2fixing microbial resources from 13 provinces over China SUN Jian2guang, XU Jing, HU Hai2yan, ZHANG Yan2chun, LIU Jun, WANG Wen2bo, SUN Yan2hua ( Ministry of Agriculture Key Laboratory of Crop Nutrition and Fertilization/ Institute of Agricultural Resources and Regional Planning, Chinese Academy of Agricultural Sciences, Beijing , China) Abstract: One hundred and eighty one asymbiotic nitrogen2fixing bacterial strains were isolated from 70 soil samples collected from 13 provinces over China. Results based on the determination of morphology, physiology and chemical proper2 ties, together with 16S rdna sequencing, indicated that these strains belong to 66 species of 24 genera, which account for about a half of currently reported genera of asymbiotic nitrogen2fixing bacteria. Taxonomic distribution of these strains was relative converging, 65 strains belongs to Paenibacillus, 52 strains belongs to Bacillus and 19 strains belongs to Arthrobac2 ter, which accounts for 36 %, 29 % and 11 % of gross resource, respectively. Strains of these 3 groups make up 76 % of gross resource. Strains of Paenibacillus and Bacillus showed significant diversity on the distribution regarding to geography and crops. Namely strains of these 2 groups could be isolated from almost every sample collected from root area of crops all over China. Key words : asymbiotic ; biological nitrogen fixation ; microbial resources ; phylogeny,,, [1],,;,,,,, : : : 948 (2007- Z1) ; 863 (2006AA10Z417) ; (2005DKA ) : (1963 ),,,,, Tel : , E2mail : ac. cn

2 6,: 1451,,,,,,,,, [2],,,, , 13,,, g 90 ml 20 min, 5 ml 30mL ACCC55 [3] ( 10 g K 2 HPO 4 3H 2 O 015 g NaCl 012 g CaCO 3 1 g MgSO 4 7H 2 O 012 g 1000 ml ph ), r/ min 72 h,, ,011 ml (ACCC %, % ), d, C 2 H 4 121, ACCC55 ( 10g nmol/ (mg pro h), K 2 HPO 4 3H 2 O 015 gnacl 012 gcaco 3 1 g MgSO 4 7H 2 O 012 g 015 g 1000 ml % 210 %,ph ),, [4],15 mm 150 mm 5 ml, h, 10 %, 72 h,100 L : [ nmol/ (mg h) ] = C 2 H 4 (nmol) / [ (mg) (h) ] : C 2 H 4 nmol = 1000 C 2 H 4 ( L) 273 P/ [2214 (273 + t) 760] [5] ; P (mm ),t ( ) ml, 3 ml 015 mol/ L NaOH 5 min, 3 ml 015 mol/ L HCl,, 110 ml 5 ml, 3 min, 595 nm A 595nm 114, [6] [7] S rdna,dna 27f : 5 2AGAGTTTGATCCTGGCTCAG23, 1492r : 5 2TACGGTTACCTTGTTACGACTT23 PCR : 95 30s 55 1 min 72 2 min, 30 DNA, DNAStar, NCBI (http :/ / www. ncbi. nlm. nih. gov) ,,,,, m 215

3 m,,,,, 4 60, 6 % 10 % NaCl 16S rdna,ncbi GenBank 97 %, : 1, 72 ; 2 66 ; , Achromobacter xylosoxidans ; Arthrobacter arilaitensi A. globif ormis A. oryzae A. oxydans A. pascens ; B acillus circulans B. flexus B. f uniculus 13 B. lichenif ormis B. megaterium B. nealsonii B. pichinotyi B. racemilacticus ; Brevibacillus choshinensis B. parabrevis ; Caulobacter henricii ; Chitinophaga ginsengisegetis ; Dyadobacter fermentans Enterobacter aerogenes ; Flavobacterium anhuiense ; Inquilinus ginsengisoli ; Lysobacter antibioticus ; Paenibacillus alginolyticus P. alkaliterrae P. amylolyticus P. barengoltzii P. glycanilyticus P. sabina ; Phyllobacterium if riqiyense ; Pseudomonas fluorescens ; Pseudoxanthomonas mexicana ; Sphingobacterium siyangensis ; Stenotrophomonas maltophilia ; Variovorax paradoxus 16S rdna ( 1), 7 : 1 Paeni2 bacillus,6 ; 2 Bre2 vibacillus,2 ; 3 Bacil2 lus,8 ; 6 Arthrobacter, 5 ; 4 4 ; 5 ; , 24 66,65 Paenibacillus, 36 % ; 52 Bacillus, 29 % ; 19 Arthrobacter, 11 % 3 76 % ( 4) 215, Bacillus Paenibacillus, (5),1 % 14 %, 71 %,, 76 %,,, Arthrobacter,,, 3,,,,, 2007 Azospira restricta [8 ], Azospirillum canadense [9 ], Azospirillum zeae [10 ], Burkholderia no2 dosa [11 ], Gluconacetobacter kombuchae [12 ], Novosphingo2 bium nitrogenifigens [13 ], Pseudacidovorax intermedius [14 ], Paenibacillus donghaensis [15 ], Paenibacillus forsythi2 ae [16 ], Paenibacillus sabinae [17 ], Paenibacillus taiwa2 nensis [18 ], Paenibacillus zanthoxyli [19 ], Phytobacter dia2 zotrophicus [20 ], Pseudoxanthobacter soli [21 ], Rhizobium oryzae [22 ], Vibrio porteresiae [23 ], 16,

4 6,: 1453

6 6,: 1455

8 6,: 1457

10 6,: 1459

12 6,: Fig. 1 Phylogenetic tree of collected nitrogen2fixing bacteria

13 Table 4 Taxonomic distribution of asymbiotic nitrogen2fixing microbial resources () () () () Genus Species Ammount Genus Species Ammount 01 Achromobacter xylosoxidans (1) 1 (015 %) 02 Arthrobacters arilaitensis (1) 19 (1015 %) globiformis (3) oryzae (1) oxidant (3) pascens (7) polychromogenes (2) ramosus (2) 03 Bacillus cereus (1) circulans (9) edaphicus (1) firmus (1) flexus (3) funiculus (13) licheniformis (1) megaterium (9) mucilaginosus (1) nealsonii (1) niacini (1) pichinotyi (4) racemilacticus (3) subtilis (2) vireti (1) yunchengensis (1) 52 (2817 %) 04 agri (2) 8 (414 %) Brevibacillus choshinensis (3) formosus (2) parabrevis (1) 05 Burkholderia vietnamiensis (1) 1 (015 %) 06 Caulobacter henricii (1) 1 (015 %) 10 Flavobacterium anhuiense (2) 2 (111 %) 11 Inquilinus ginsengisoli (2) 2 (111 %) 12 Lysobacter gummosus (1) 1 (015 %) 13 Micrococcus luteus (2) 2 (111 %) 14 Paenibacillus agarexedens (6) alginolyticus (1) alkaliterrae (2) amylolyticus (1) barengoltzii (1) caespitis (6) daejeonensis (2) forsythia (1) glycanilyticus (4) graminis (2) humicus (11) kobensis (4) panacisoli (2) polymyxa (2) sabina (13) stellifer (2) thailandensis (2) validus (3) 15 Phyllobacterium brassicacearum (3) 65 (3519 %) 8 (414 %) ifriqiyense (5) 16 Pocheonia soli (1) 1 (015 %) 17 Pseudomonas fluorescens (4) 4 (212 %) mexicana (1) 1 (015 %) 18 Pseudoxanthomonas 19 Pusillimonas terrae (1) 1 (015 %) 20 Sphingobacterium siyangensis (1) 1 (015 %) 07 Chitinophaga 08 Dyadobacter ginsengisegetis (2) fermentans (2) 2 (111 %) 2 (111 %) 21 Sphingomonas azotifigens (1) 1 (015 %) 22 Sporolactobacillus laevolacticu (2) 2 (111 %) 23 Stenotrophomonas maltophilia (1) 1 (015 %) 09 aerogenes (1) 1 (015 %) 24 paradoxus (2) 2 (111 %) Enterobacter Variovorax :, Note : The number behind the species name account for the isolate amount, the pencentage account for the propotion in all isolates.

14 6,: 1463

16 6,: 1465 Paenibacillus sabinae,,, 50,24, Azospirillum Herbaspirillum Gluconacetobacter [24 ],,,,Bacillus Paenibacillus,, : [1 ]. [A].. [ C]. :, Chen W X. Biological nitrogen fixation [ A ]. Soil Science Society of China ( ed. ). Proceeding of conference on nitrogen cycling and a2 griculre environment[ C]. Xiamen : Xiamen University Press, [2 ]. [ A]., [ C]. :, Li J L. Current situation and consideration on biological nitrogen fixa2 tion research in China [A]. Zhou G Z (ed. ). Progress inscience and technology- Proceeding of conference onscience and technology face new centry[ C]. Beijing : Scientific and Technology Press of China, [3 ]. [M]. :,20011 Agricultural Culture Collection of China. List of agricultural cultures of China [M]. Beijing : China Agricultural Scientech Press, [4 ],,. [J ].,1998,25 (5) : Xu Q F, Huang X L, Chen T W. The isolation identification and de2 termination of the nitrogen2fixing abilities of eight bacillus strains. [J ]. Microbiol., 1998, 25 (5) : [5 ],. [M]. :,20021 Zhao B, He S J. Microbiology experiment [ M ]. Beijing : Science Press, [6 ]. [ M]. :, Dong X Z. Manual of systermatic determinative bacteriology [ M ]. Beijing : Science Press, [7 ],,. () [M]. :,19991 Shen P, Fan X R, Li G W. Microbiology experiment (3rd Ed. ) [M]. Beijing : High Education Press, [ 8 ] Bae H, Brian A, Rash F, Rainey M et al. Description of Azospira re2 stricta sp. nov., a nitrogen2fixing bacterium isolated from groundwater [J ]. Int. J. Syst. Evol. Microbiol., 2007, 57 : [9 ] Mehnaz S, Weselowski B, Lazarovits G. Azospirillum canadense sp. nov., a nitrogen2fixing bacterium isolated from corn rhizosphere [J ]. Int. J. Syst. Evol. Microbiol., 2007, 57 : [10 ] Mehnaz S, Weselowski B, Lazarovits G. Azospirillum zeae sp. nov., a diazotrophic bacterium isolated from rhizosphere soil of Zea mays [J ]. Int. J. Syst. Evol. Microbiol., 2007, 57 : [11 ] Chen W, Faria S, Euan J, Geoffrey E. Burkholderia nodosa sp. nov., isolated from root nodules of the woody Brazilian legumes Mi2 mosa bimucronata and Mimosa scabrella[j ]. Int. J. Syst. Evol. Mi2 crobiol., 2007, 57 : [12 ] Dutta D, Gachhui R. Nitrogen2fixing and cellulose2producing Glu2 conacetobacter kombuchae sp. nov., isolated from Kombucha tea[j ]. Int. J. Syst. Evol. Microbiol., 2007, 57 : [13 ] Addison L, Foote M, Reid M, Lloyd2Jones G. Novosphingobium ni2 trogenifigens sp. nov., a polyhydroxyalkanoate2accumulating dia2 zotroph isolated from a New Zealand pulp and paper wastewater [J ]. Int. J. Syst. Evol. Microbiol., 2007, 57 : [14 ] Kgmpfer P, Thummes K, Chu H et al. Pseudacidovorax intermedius gen. nov., sp. nov., a novel nitrogen2fixing betaproteobacterium isolated from soil[j ]. Int. J. Syst. Evol. Microbiol., 2008, 58 : [15 ] Choi J, Im W, Yoo J et al. Paenibacillus donghaensis sp. nov., a xylan2degrading and nitrogen2fixing bacterium isolated from East Sea sediment[j ]. J. Microbiol. Biotechnol., 2008, 18 : [16 ] Ma Y, Chen S. Paenibacillus forsythiae sp. nov., a nitrogen2fixing species isolated from rhizosphere soil of Forsythia mira [J ]. Int. J. Syst. Evol. Microbiol., 2008, 58 : [17 ] Ma Y, Xia Z, Liu X, Chen S. Paenibacillus sabinae sp. nov., a nitrogen2fixing species isolated from the rhizosphere soils of shrubs [J ]. Int. J. Syst. Evol. Microbiol., 2007, 57 :6-111 [18 ] Lee F, Kuo H, Tai C et al. Paenibacillus taiwanensis sp. nov., isolated from soil in Taiwan [J ]. Int. J. Syst. Evol. Microbiol., 2007, 57 : [ 19 ] Ma Y, Zhang J, Chen S. Paenibacillus zanthoxyli sp. nov., a novel nitrogen2fixing species isolated from the rhizosphere of Zanthoxylum simulans[j ]. Int. J. Syst. Evol. Microbiol., 2007, 57 : [20 ] Zhang G, Peng G, Wang E et al. Diverse endophytic nitrogen2fixing bacteria isolated from wild rice Oryza rufipogon and description of Phytobacter diazotrophicus gen. nov. sp. nov. [J ]. Arch Microbi2 ol., 2008, 189 : [21 ] Arun B, Schumann P, Chu H et al. Pseudoxanthobacter soli gen. nov., sp. nov., a nitrogen2fixing alphaproteobacterium isolated from soil[j ]. Int. J. Syst. Evol. Microbiol., 2008, 58 : [22 ] Peng G, Yuan Q, Li H et al. Rhizobium oryzae sp. nov., isolated from the wild rice ( Oryza alta) [J ]. Int. J. Syst. Evol. Microbiol., 2008, 58 : [23 ] Rameshkumar N, Youhei F, Sawabe T, Nair S. Vibrio porteresiae sp. nov., a diazotrophic bacterium isolated from a mangrove2associat2 ed wild rice[j ]. Int. J. Syst. Evol. Microbiol., 2008, 58 : [24 ] Bhattacharjee R, Singh A, Mukhopadhyay S. Use of nitrogen2fixing bacteria as biofertiliser for non2legumes : prospects and challenges [J ]. Appl. Microbiol. Biotechnol., 2008, 80 :

1 GIS 95 Y = F y + (1 F) (1) 0 0 Y0 kg/hm 2 /day F y 0 y c kg/hm 2 /day [12] y m 20 kg/hm 2 /hour Y = cl cn ch G [ F( y ) T m yo + (2) (1 F)(

1 GIS 95 Y = F y + (1 F) (1) 0 0 Y0 kg/hm 2 /day F y 0 y c kg/hm 2 /day [12] y m 20 kg/hm 2 /hour Y = cl cn ch G [ F( y ) T m yo + (2) (1 F)( 24 1 Vol.24 No.1 94 2008 1 Transactions of the CSAE Jan. 2008 2008 1 100094 2 100035 3 100081 4 100081 5 100101 GIS ( ) 65.12 16.82 13.74 15.27 11.07 t/(hm 2 a) 10.93% 41.43% 46.93% 65.4%. Bi Jiye, Zhu