Acta Lab Anim Sci Sin October 2013 Vol. 21. No. 5 http / /primerexplorer. jp /elamp /in- ELISA dex. html LA-320C 1. 4 LAMP ETEC

Size: px

Start display at page:

Download "Acta Lab Anim Sci Sin October 2013 Vol. 21. No. 5 http / /primerexplorer. jp /elamp /in- ELISA dex. html LA-320C 1. 4 LAMP ETEC"

磐题邱
5 years ago
Views:

1 ACTA LABORATORIUM ANIMALIS SCIENTIA SINICA October 2013 Vol. 21 No. 5 檵檵檵檵檵檵檵檵檵檵 LAMP ETEC GenBank LT S LAMP LAMP PCR LAMP 100 pg /μl PCR LAMP PCR PCR 33. 3% LAMP 60 min PCR LAMP 90 min 92. 6% PCR 3 ETEC LAMP ETEC LAMP Q95-33 A Doi /j. issn Establishment and evaluation of the loop-mediated isothermal amplification LAMP assay in detection of enterotoxigenic Escherichia coli ZHANG Xiao-fei ZHANG Zhao-jun ZHANG Guang-zhou CUI Xiao-xia ZHAO Shuang DING Ming BAI Jie-ying ZENG Lin Laboratory Animal Center Academy of Military Medical Sciences Beijing China Abstract Objective Using loop-mediated isothermal amplification LAMP assay to develop a rapid convenient sensitivity and specificity of enterotoxigenic Escherichia coli ETEC detection method and evaluate the specificity and sensitivity of this method for detection and diagnosis of bacterial diarrhea in laboratory animals. Methods According to the published E. coli LT toxin gene sequences S to design PCR and LAMP primers and to compare the specificity and sensitivity of LAMP with that of PCR. Result The detection limit of the established LAMP method were 100 pg its sensitivity was 10 times higher than that of PCR and had a high specificity. Using PCR and LAMP to detect 27 feces samples of monkey diarrhea the results of LAMP within 60 min were the same as that of PCR with a positive rate of 33. 3%. But the positive rate of LAMP within 90 min was 92. 6% about 3 times higher than that of PCR. Conclusions We have established an ETEC LAMP detection method which is highly specific sensitive convenient suitable for rapid detection of ETEC clinical samples. Key words Enterotoxigenic Escherichia coli ETEC Loop-mediated isothermal amplification LAMP Detection enterotoxigenic Escherichia coli ETEC 1 heat-labile enterotoxin LT heat-stable enterotoxin ST ETEC CWS11J ZXJ @ 163. com baijieying@ 126. com zenglin1965@ 126. com

2 Acta Lab Anim Sci Sin October 2013 Vol. 21. No. 5 http / /primerexplorer. jp /elamp /in- ELISA dex. html LA-320C 1. 4 LAMP ETEC PCR Real Time Turbidimeter LA DNA LAMP Kit 7 LAMP ETEC 1. 5 LAMP loop-mediated isothermal amplification LA-320C LAMP LAMP > μL 1. 6 LAMP LAMP ETEC TIANamp Bacteria DNA Kit LAMP DNA 1. 4 ETEC LAMP ~ PCR DNA LAMP F3 B3 PCR % ATCC DNA ATCC CMCC CMCC PCR TIANamp Bacteria DNA Kit CMCC PCR CMCC ~ PCR 1. 1 DHL Column Stool DNAOUT r /min 27 DNA TIANamp Bacteria DNA Kit ETEC LAMP PCR NanoDrap LAMP GenBank LT LT 2. 1 LAMP S ETEC DNA LAMP Kit 13 Noro Virus LAMP 2 LAMP 1 ETEC LAMP

2013 10 21 5 Acta Lab Anim Sci Sin October 2013 Vol. 21. No. 5 33 25 μl 2 Reaction Mix12. 5 μl F3 1 μl B3 1 μl FIP 0. 8 μl BIP 0. 8 μl Bst 1 μl 2 μl 4.

1 Primer name F3 B3 FIP BIP LAMP The LAMP primer sequences of ETEC Promer sequences AGATATATGGATGGTATCGTGTT TGTAATTGTTCTTGATGAATCTCC GCCGGAGCTATATTCAGATTTCTG- TATTTTGGTGTGATTGATGAACG

3 Acta Lab Anim Sci Sin October 2013 Vol. 21. No μl 2 Reaction Mix12. 5 μl F3 1 μl B3 1 μl FIP 0. 8 μl BIP 0. 8 μl Bst 1 μl 2 μl 4. 9 μl F3 5 Es Taq MasterMix 10 μl RNase-Free water 6 μl pmol /μl B3 5 pmol /μl FIP 40 pmol /μl BIP 40 pmol /μl 1 Tab. 1 Primer name F3 B3 FIP BIP LAMP The LAMP primer sequences of ETEC Promer sequences AGATATATGGATGGTATCGTGTT TGTAATTGTTCTTGATGAATCTCC GCCGGAGCTATATTCAGATTTCTG- TATTTTGGTGTGATTGATGAACG GGTTACAGATTAGCAGGTTTCCCCAAC- CTTGTGGTGCATGA 2. 2 LAMP DNA LAMP Kit 1. 2 ATCC LAMP 90 min LA-320C LAMP LA-320C 5 PCR LAMP min > 0. 1 Fig. 5 M Marker A ETEC The PCR productis of ETEC LAMP 1 μl LAMP DNA LAMP Kit DEPC 3 7 ETEC LAMP 2. 5 LAMP min ~ PCR DNA LAMP Fig. 6 Sequencing results of the PCR products 10-4 LAMP 2. 7 PCR 2. 6 PCR DNA LAMP F3 B3 PCR 1. 2 ETEC DNA PCR 20 μl DNA 2 μl F3 1 μl B3 1 μl min s s s min % 218 bp 5 Gel Extraction Kit GenBank 6 99% M Mark A ETEC ETEC PCR ETEC 218 bp 7 ETEC 10

34 2013 10 21 5 Acta Lab Anim Sci Sin October 2013 Vol. 21. No. 5 10-3 8 90 min PCR 27 9 33. 3% LAMP 60 min LAMP 90 min 25 92.

12 022 7 Negative control. Fig. 7 PCR specific detection of ETEC M Mark 1 1. 0 2 ~ 8 1. 0 10-1 ~ 1. 0 10-7 8 PCR Note M Marker 1 1.

5 PCR 10 16 17 LAMP 18 3 43 min 4 Fig. 8 Detection of the PCR sensitivity of ETEC 27 2.

4 Acta Lab Anim Sci Sin October 2013 Vol. 21. No min PCR % LAMP 60 min LAMP 90 min % PCR 3 M Mark PCR Note M Marker Negative control. Fig. 7 PCR specific detection of ETEC M Mark ~ ~ PCR Note M Marker ~ to dilution. 3 ETEC LAMP LA-320C 200 μg /μl pgetec 15 Yamasaki LAMP inva PCR LAMP min 4 Fig. 8 Detection of the PCR sensitivity of ETEC LAMP PCR LAMP PCR LAMP 60 min Column Stool DNAOUT 27 PCR 90 min DNA ETEC % LAMP 9 8 PCR min min LAMP 60 M Marker 1 ~ 27 1 ~ 27# 10 PCR Note M Marker 1-27 Feces samples 1-27#. Fig. 10 ETEC PCR detection of feces samples

5 Acta Lab Anim Sci Sin October 2013 Vol. 21. No min LAMP ETEC LAMP ETEC LAMP PCR 100 pg Clin Microbial ~ J J Call DR Brockman FJ Chandler DP. Detecting and genotyping Escherichia coli O157 H7 using nultiplexed PCR and nucleic acid microarrays J. Int J Food Microbiol Lee W Park KS Kim YW et al. Protein array consisting of solgel bioactive platform for detection of E. coli O157 H7 J. Biosens Bioelectr O157 J Gehring AG Tu SI. Enzyme-linked immunomagnetic electrochemical detection of live Escherichia coli O157 H7 in apple juice J. J Food Protec Notomi T Okayama H Masubuchi H et al. Loop-mediated isothermal amplification of DNA J. Nucl Acids Res Chen HT Zhang J Yang SH et al. Rapid detection of porcine parvovirus DNA by sensitive loop-mediated isothermal amplification J. J Virol Methods Iwamoto T Sonobe T Hayashi K. Loop-mediated isothermal amplification for direct detection of mycobacterium tuberculosis complex M. avium and M. intracellulare in sputum samples J. J 11 Saito R Misawa Y Moriya K et al. Development and evaluation of a loop-mediated isothermal amplification assay for rapid detection of Mycoplasma pneumoniae J. J Med Microbiol Nagamine K. Watanabe K Ohtsuka K et al. Loop-mediated i- sothermal amplification reaction using a monde natured template J. Clin. Chem Nagamine K. Hase T Notomi T. Accelerated reaction by loopmediated isothermal amplification using loop primers J. Molec Cell Probes O157 J Wang L Li L Alam MJ et al. Loop-mediated isothermal amplification method for rapid detection of the toxic dino-flagellate Alexandrium which causes algal blooms and poisoning of shellfish J. FEMS Microbiol Lett Han F Ge B. Evaluation of a loop-mediated isothermal amplification assay for detecting Vibrio vulnificus in raw oysters J. 6 Demarco DR Lim DV. Detection of Escherichia coli O157 H7 in 10 and 25-gram ground beef samples with an evanescent-wave Food Borne Pathogens Dis biosensor with silica and polystyrene wave guides J. J Food 18 Song T Toma C Nakasone N et al. Sensitive and rapid detection of Shigella and enteroinvasive Escherichia coli by a loop-me- Protect diated isothermal amplification method J. FEMS Microbiol J Lett

#89:!" ;$!"#!$" %&'()&*+,-./01234567 #$%&'()*+,-./*0(123+45*267/839+8:(/;+5<+3*,8(,.(36/(5,,=-7/:*+3/:(*2,36/>7+59+7=5*.*?+3*,89+22+@9*8 99999:/3/?3*,89,.9/83/>,3,A*B/8*?912?6/>*?

"$:;<=>% &,3/J9K==/>J9&/B+3*;/9>/2<53L9F,M/>J9H,2*3*;/9>/2<53 "#$% & I6/9F%GH9>/+?3*,89,.91I1NOP+::(*8(.5<,>/2?/83E +! "!!QRS" " T! RR"ST "!! QSSR" " R! QSSU" " Q! Q"TQT " V!

6 #89:!" ;$!"#!$" %&'()&*+,-./ :/3/?3*,89,.9/83/>,3,A*B/8*?912?6/>*?6*+9?,5*9 9CD<55(3/A3(,8(=+B/(!"E <! F%GH!"#$%&'()* "#$%! I6/9,=3*7+593/7=/>+3<>/9,.9:/3/?3*,89,.9F%GH9>/+?3*,8 +!,!-.#$/0"1!2.#$/0# <& F%GH!"$:;<=>% &,3/J9K==/>J9&/B+3*;/9>/2<53L9F,M/>J9H,2*3*;/9>/2<53 "#$% & I6/9F%GH9>/+?3*,89,.91I1NOP+::(*8(.5<,>/2?/83E +! "!!QRS" " T! RR"ST "!! QSSR" " R! QSSU" " Q! Q"TQT " V! "TSTT " U! W! <' A BC.)* &,3/J9"J9!QRS"L9TJ9RR"STL9!J9QSSR"L9RJ9QSSU"L9QJ9Q"TQTL9VJ9"TSTTL9UJ9&/B+3*;/9?,83>,5L9WJ9H,2*3*;/9?,83>,5X "#$% ' Y=/?*.*?9:/3/?3*,89,.91I1N9M*369+9>/+593*7/93<>4*:*7/3/>9F%-!TS '!(

!"#!$" %&'()&*+,-./01234567 #89:!" ;$ #$%&'()*+,-./*0(123+45*267/839+8:(/;+5<+3*,8(,.(36/(5,,=-7/:*+3/:(*2,36/>7+59+7=5*.*?+3*,89+22+@9*8 99999:/3/?3*,89,.9/83/>,3,A*B/8*?912?6/>*?6*+9?

7 !"#!$" %&'()&*+,-./ #89:!" ;$ 99999:/3/?3*,89,.9/83/>,3,A*B/8*?912?6/>*?6*+9?,5*9 9CD<55(3/A3(,8(=+B/(!"E <!!"#$%"&'()*+,- "#$%! I5,?J9%!H$"-H$K!"-K / " I5,?J9I!H$"-H$K!L-"M / " I5,?J9 H!H$"-H$K!"N-OP / 0 123" I5,?JQR!H$"-H$!!OS-ON /0123#H$P!4+56$ <& G1H9T%UV,- &,3/W9 I5,?J9 %W9 H$"-H$KW"-KX9 2+7=5/2Y9 I5,?J9 IW9 H$"-H$KWL-"MX9 2+7=5/2Y9 I5,?J9 HWH$"-H$KW"N-OPX9 2+7=5/2Y9 I5,?J9RW9H$"-H$!WOS-ONX92+7=5/2Z9H$PW9V,2*3*;/9?,83>,5[ "#$% & 1G1H9T%UV9:/3/?3*,89,.9./?/292+7=5/2 %!%

Syngene GBOXHR Retsch MM400 KQ DE Eppendorf Table 1 The sources of Astragali Radix and Hedysarum Radix No. 1 AMM2011_NMGTY Astr

Syngene GBOXHR Retsch MM400 KQ DE Eppendorf Table 1 The sources of Astragali Radix and Hedysarum Radix No. 1 AMM2011_NMGTY Astr PCR 龙平, 崔占虎, 李虔全, 徐建平, 张春红, 周立社 * *, 李旻辉 ( 包头医学院, 内蒙古包头 014060) DNA 30 28 DNA trnl-trnf PCR PCR 136 bp 323 bp 10% PCR PCR Astragalus membranaceus Fisch. Bge. var. mongho- licus Bge. Hsiao A. membranaceus