72 11 [ 2],,, 29 [ 3-5 ],,,, [ 6],,,, 1 [ 7-8] 211, Fig. 1 Diseased P. leopardus,, TCBS ( 1), VP 1, X11YD5, 43, API,, ( 32E), S rdna mreb rc

Transcription

1 South China Fisheries Science Vol. 11, No. 4 Aug., 215 doi: / j. issn , 2 1,, ,,, ( 1.,, 513; 2., 2136) : 211 ( Plectropomus leopardus),, 1 X11YD5,, 3. 8 g ( Epinephelus coioides) ( LD 5 ) cfu g - 1, 16S rdna toxr rpod mreb topa rctb 6,, X11YD5 ( Vibrio harveyi), X11YD : ; ; ; 16S rdna : S : A : ( 215) Identification and drug sensitive test of bacterial Pathogens from Plectropomus leopardus with tail fester disease GU Liangbin 1, 2, XU Liwen 1, FENG Juan 1, SU YouLu 1, LIU Guangfeng 1, GUO Zhixun 1 ( 1. Key Lab. of South China Sea Fishery Resource Exploitation & Utilization, Ministry of Agriculture; South China Sea Fisheries Research Institute, Chinese Academy of Fishery Science, Guangzhou 513, China; 2. College of Fisheries and Life Sciences of Shanghai Ocean University, Shanghai 2136, China) Abstract: In 211, there was an outbreak in a Plectropomus leopardus farm in Wenhui Town, Yandui Village, Hainan Province. The color of sick fish turned white and the tail fin festered. We isolated a Strain X11YD5 from sick P. leopardus which was proved to be pathogen by artificial infection and the LD 5 was cfu g - 1 in Epinephelus coioides using Karber method. To determine the molecular characteristics of X11YD5, we amplified the 16S rdna, transmembrane regulatory protein ( toxr), RNA polymerase 7 factor ( rpod), actin-like cytoskeleton protein ( mreb), topoisomerase ( topa) and replication origin-binding protein ( rctb) by PCR. Sequence analysis indicates that X11YD5 belonged to V. harveyi. Drug sensitivity test shows that X11YD5 was sensitive to norfloxacin, ofloxacin, ciprofloxacin, enrofloxacin and cotrimoxazole. Key words: Plectropomus leopardus; Vibrio harveyi; tail fester disease; 16S rdna [ 1 ] ( Plectropomus leopardus),,,,,, : ; : : ( ) ; ( 214KX64 ) ; ( 215XH3) : ( ),,, guliangbin212@ 163. com : ( ),,, jannyfeng@ 163. com

2 72 11 [ 2],,, 29 [ 3-5 ],,,, [ 6],,,, 1 [ 7-8] 211, Fig. 1 Diseased P. leopardus,, TCBS ( 1), VP 1, X11YD5, 43, API,, ( 32E), S rdna mreb rctb rpod topa toxr X11YD5 16 DNA: 5 1 L, (, PCR PCR 3. 8 g, cm), 1 2 [ 1 ] 5 L PCR 1%, 7 d 1. 2 ( ), ( ) ) TCBS ( K-B ) [ 11 ], 28 NCCL, 1 L (, 1 8 cfu ml - 1 ) MHA, 1 min m 1. 2 m, 1, 4, 1, 3, 15, 2 X11YD5 2216E h,, X11YD5 1 4,. 2, ml,,,,,,, 7 1 X-1 X11YD5 d min, ( ) 1 15 min, 3 5 min, 12 r min min,, 13 V, 25 min PCR ( [ 9 ] , 1 5 cfu g - 1, h, , ( LD 5 ) 1. 67

3 4 : 73 1 Tab. 1 Information of primers gene locus protein products primer ( 5 3 ) primer sequence PCR / bp PCR product / annealing temperature 16S rdna - 8F AGAGTTTGATCCTGGCTCAG R GGTTACCTTGTTACGACTT rctb ATGCCNGARGGYTTYAARAG rctb-r GTWGGMGCCATRTTRCGYTT toxr toxr-f GAAGCAGCACTCACCGAT toxr-r GGTGAAGACTCATCAGCA topa topa-f GAGATCATCGGTGGTGATG 8 63 topa-r GAAGGACGAACGCTTCGTG mreb mreb-f ACTTCGTGGCATGTTTTC 1 59 mreb-r CCGTGCATATCGATCATTTC rpod RNA 7 rpod-f ACGACTGACCCGGTACGCATGT 78 5 AYATGMGNGARATGGGNACNGT rpod-r ATAGAAATAACCAGACGTAAGT TNGCYTCNACCATYTCYTTYT 2 PCR Tab. 2 System and reaction condition of PCR amplification PCR PCR system PCR revolving parameter reactant / L volume step / temperature time number of cycle Premix Taq min 1 template min 35 upstream primer s 35 downstream primer min 35 sterilized distilled water min 1 3 X11YD5 Tab. 3 Pathogenicity of Strain X11YD5 to E. coioides / cfu ml - 1 / ml / / / % group bacterial concentration dosage individual number death number mortality control. 9% X-1 2, TCBS,,,, X-1, ( 2), X11YD5 O/129( 1 g - 1 ), O/129 ( 15 g

4 X11YD5 ( 1 ) Fig. 2 Gram-staining of Strain X11YD5-1 ) ; ( Na + ), 3% ( NaCl) 6% NaCl, 8% NaCl 1% NaCl ; Fig. 3 Antibiotic resistance of X11YD5 to Gentamicin, 28 35, ONPG,, VP,,, [ 7, 9 ] X11YD5 X ( 3), X-1 X11YD5, 5, B G 11 2 ( 5) S rdna mreb rctb toxr topa rpod X11YD5 6 ( 4, 16S rdna KM657348) ( Lateolabrax Japonicus) [ 1 2] ( Rachycentron canadum) [ 13 ] ( http: blast. st-va. ncbi. nlm. nih. gov/blast. cgi), X11YD5 6 ( Penaeus chinensis) [ 1 4] ( Meretrix meretrix) [ 15 ] ( E. awoara) [ 16],, MEGA 6. NJ ( 5 1) ( Babylonia areolata) [ ] 6, [ 1 9] ( V. harveyi) K-B X11YD5 ( ) ( ) ( ) ( ) Cefixime, Furazolidone and Enrofloxacin with K-B method X11YD5 rpod toxr PCR Fig. 4 Agarose electrophoresis of rpod, toxr PCR products of Strain X11YD5, [ 7, 18],,, [ 2 ],

5 4 : 75 4 X11YD5 Tab. 4 Comparison of main physiological and chemical characteristics of Stain X11YD5, X-1 and V. harveyi detection item detection result X11YD5 X-1 V. harveyi Gram staining TCBS TCBS grow G G Y / G O/129( 15 g) O/129( 1 g) not NaCl tryptone broth % NaCl 3% NaCl tryptone broth % NaCl 6% NaCl tryptone broth % NaCl 8% NaCl tryptone broth % NaCl 1% NaCl tryptone broth grow grow grow grow grow ONPG ONPG reaction catalase oxidase nitrate reduction VP VP reaction methyl red heteroauxing hydrogen sulfide arginine hydrolase arginine decarboxylase iysine decarboxylase ornithine decarboxylase - - ND glucose aerosis arabinose inosite - - ND mannitol raffinose - - ND rhamnose - - D sucrose - - D lactose salicin sorbitol - - ND melibiose carbamide - - ND glucose maltose - - D gelatin : +. ; -. ; D., ; ND. Note: +. positive; -. negative; D. sometimes positive, sometimes negative; ND. no data

6 X11YD5 X-1 Tab. 5 Antibacterial activity of pathogen X11YD5 and X-1 to different antimicrobial agents chemical B Polymyxin B Kanamycin Ofloxacin dose X11YD5 X-1 / mm /mm diameter susceptibility diameter 25 g R 8 R 3 g R 7 R 5 g S 22 S susceptibility G Penicillin G 1 U R R Gentamicin Tetracycline Furazolidone Norfloxacin Amoxicillin Rifampicin Cotrimoxazole Erythrocin Ciprofloxacin Chloramphenicol Cefixime Enrofloxacin 1 g R 13 R 3 g R 14 R 3 g R 12 R 1 g S 37 S 1 g - 1 R 13 R 5 g - 1 R R g S 23 S 15 g R 19 R 5 g S 26 S 3 g R R 5 g R 17 R 5 g S 37 S : R. ; S. Note: R. resistance; S. sensitivity 5 X11YD5 16S rdna Fig. 5 Dendrogram of 16S rdna sequence analysis of X11YD5

7 4 : 77 Fig. 6 6 X11YD5 mreb Dendrogram of mreb sequence analysis of X11YD5 Fig. 7 7 X11YD5 rctb Dendrogram of rctb sequence analysis of X11YD5

8 78 11 Fig. 8 8 X11YD5 rpod Dendrogram of rpod sequence analysis of X11YD5 Fig. 9 9 X11YD5 topa Dendrogram of topa sequence analysis of X11YD5

9 4 : 79 Fig. 1 1 X11YD5 toxr Dendrogram of toxr sequence analysis of X11YD5 ( V. harveyi) MLSA, 1 X11YD5, ( actin-like cytoskeleton protein, mreb),, ( replication origin-binding protein, X-1 rctb) RNA 7 ( RNA polymerase 7 X11YD5, factor, rpod) ( topoisomerase, topa) X11YD5 ( transmembrane regulatory protein, [ 21-22, ] 16S rdna toxr) 5, [ ] 16S rdna 16S rd-, NA,, 16S rdna ( V. campnellii ) V. communis 5 ( V. owensii), 3 ( Harveyi,, clade), ( V. rotiferianus) ( V. mytili) ( V. natriegens) rdna, 1% [ ], 16S rdna BLAST VP, X11YD5 16S rdna, 99%, 16S rdna ( multi-locus se- 16, X11YD5 quence analysis, 97%, API ( 32E),, [ 23] 11, 16S, X11YD5 MLSA) 4 [ 1, 26],,

10 8 11, [ 15],, [ 2] [ 2],, [ ] ;, [ 2],, : [ J],, 211( 4) : [ 2],,,. [ J]., 29, 9 ( 11 ) : [ 3],,,. [ J]., 211( 1) : the Harveyi clade[ J]. Appl Microbiol, 211, 54 ( 2 ) : 16 - [ 4],,,. [ J]., 214( 3), 5 ( 1) : [ 9],. [ M]. :, 21: [ 1] ASCUAL J, MACIAN M C, ARAHAL D R, et al. Multilocus sequence analysis of the central clade of the genus Vibrio by using the 16 S rrna, reca, pyrh, rpod, gyrb, rctb and toxr genes [ J]. Int J Sys Evol Microbiol, 21, 6( 1) : [ 11] Clinical and Laboratory Standards Institute. Performance standards for antimicrobial susceptibility testing; sixteenth informational supplement[ S ]. CLSI document M1-S16. Wayne, Pa, USA: Clinical and Laboratory Standards Institute, 26. [ 12],,,. ( ) [ J]., 22, 9 ( 1 ) : [ 13],,. 1 [ J]., 212, 8( 2) : 2-6. [ J]., 26, 13( 5 ) : [ 14],. [ J]., 21, 6( 5 ) : 21 - [ J]., 1998, 29( 4) : ,,,. WG172 [ J]., 21, 29 ( 2 ) : [ 16],,,. [ J]., 24, 28( 3) : [ 17],,,. [ J]., 213, 9 ( 5) : [ 18],,,. [ J]., 214, 35 ( 1) : [ 19]. ( ) [ D]. :, 21.,. [ J]., 214, 33 ( 4) : [ 21 ] CANO-GOMEZ A, H J L, OWENS L, et al. Multilocus se- [ 1],,,. quence analysis provides basis for fast and reliable identification of Vibrio harveyi-related species and reveals previous misidentification of important marine pathogens[ J]. Sys Appl Microbiol, 211, 34 ( 8) : [ 22 ] HOFFMANN M, MONDAY S R, FISHER M, et al. Genetic and phylogenetic evidence for misidentification of Vibrio species within 165. [ 23 ] SAWABE T, KITA-TSUKAMOTO K, THOMPSON F L. Inferring [ 5],,,. the evolutionary history of Vibrios by means of multilocus sequence [ J]., 212( 11), 34( 4 ) : analysis [ J]. J Bacteriol, 27, 189( 21) : [ 6],,,. [ 24] CANO G A, GOULDEN E F, OWENS L, et al. Vibrio owensii [ J]., sp. nov., isolated from cultured crustaceans in Australia [ J]. 214, 26( 5) : FEMS Microbiol Lett, 21, 32 ( 2) : [ 7],,,. [ 25] CHIMETTO L A, CLEENWERCK I, ALVES N, et al. Vibrio [ J]., 21, 29( 6 ) : communis sp. nov., isolated from the marine animals Mussismilia [ 8],,,. hispida, Phyllogorgia dilatata, Palythoa caribaeorum, Palythoa [ J]., 213, 32( 9 ) : variabilis and Litopenaeus vannamei [ J]. Int J Syst Evol Microbiol, 211, 61( 2) : [ 26] FRANCO P F, HEDREYDA C T. Amplification and sequence a- nalysis of the full length toxr gene in Vibrio harveyi [ J]. J Gen Appl Microbiol, 26, 52( 5 ) : [ 27] HOFFMANN M, MONDAY S R, MCCARTHY P J et al. Genetic and phylogenetic evidence for horizontal gene transfer among ecologically disparate groups of marine Vibrio[ J]. Cladistics, 213, 29( 1) : [ 28] RIVERA-POSADA J A, PRATCHETT M, CANO-GOMEZ A, et al. Refined identification of Vibrio bacterial flora from Acanthasther planci based on biochemical profiling and analysis of housekeeping genes[ J]. Dis Aquat Org, 211, 96 ( 2) : [ 29],,,. [ 3],,,. 26.