Chinese Journal of Applied Entomology mtdna ND1 * 1** Oedaleus asiaticus Bienko mtd

Size: px

Start display at page:

Download "Chinese Journal of Applied Entomology mtdna ND1 * 1** Oedaleus asiaticus Bienko mtd"

羊琢米
4 years ago
Views:

1 mtdna ND1 * 1** Oedaleus asiaticus Bienko mtdna ND1 Myrmeleotettix palpalis Angaracris barabensis UPGMA NJ 347 bp A + T 76. 6% % 3 A + T H Pi ~ Nm 1 AMOVA % % mtdna ND1 mtdna ND1 Sequence analysis of mtdna ND1 gene and relationships of geographical populations of Oedaleus asiaticu GAO Shu-Jing 1** LIU Ai-Ping 1 HAN Jing-Ling 2 YAN Zhi-Jian 1 XU Lin-Bo 1 LI Dong-Wei 3 1. Grassland Research Institute of Chinese Academy of Agricultural Sciences Hohhot 2. Tangshan Research Institute of Agricultural Science Tangshan 3. Inner Mongolia Agriculture University Insititite of Agriculture Hohhot China China China Abstract Mitochondrial DNA ND1 gene sequences were sequenced in 31 individuals of Oedaleus asiaticu Bienko from 7 geographical populations in Inner Mongolia including 1 related species and 2 outgroup species Myrmeleotettix palpalis and Angaracris barabensis. We compared homologous sequences calculated nucleotide composition and constructed a molecular phylogenetic tree with the Neighbor-Joining and UPGMA method. In the sequences obtained A + T was about 76. 6% and 22 nucleotide sites about 7. 26% were substituted. A + T was much higher at the third site than the other two sites in every amino acid code. 18 hapotypes were detected in 28 individuals hapotype diversity index H and mean nucleotide diversity index Pi reached and respectively. Genetic divergence F st was and gene flow Nm was greater than 1. An AMOVA test indicated that there was % genetic variation within and % between populations. The phylogenetic trees suggested that different individuals from the 7 areas in Inner Mongolia were located in different clusters but no clear relationships between haplotypes and geographical regions could be inferred. Because the branches of each cluster are parallel there is no clear difference between the different areas. Key words Oedaleus asiaticus geographical populations mtdna ND1 genetic relationship Oedaleus asiaticus Bienko Orthoptera Acridoidea * ** shujinggao688@ 163. com

2 Oedipodidae Oedaleus DNA DNA NADH ND1 NADH-dehydro-gelmse subunit1 Myrmeleotettix palpalis Angaracris barabensis DNA DNA Moritz et al Gray DNA ND mtdna Chilo supperssalis COII Table 1 1 mtdna Specimens of Oedaleus asiaticu for mtdna analysed Group Sites Code Number. Collection date year. month Location S E ' N 41 22' D E ' N 41 21' H E ' N 49 51' C E ' N 42 26' T E ' N 43 59' A E ' N 40 47' Z E ' N 46 11' 1. 2 DNA DNA 0. 8 ml 200 mmol / L Tris-Cl ph mmol / L EDTA 1% SDS 50 μg / ml K 37 4 h NaCl 150 mmol / L 0. 4 ml TAE RNA A 50 μg / ml 37 5 h K 120 μg 5 h DNA 1

3 4 mtdna ND μl TE DNA 1. 3 PCR Simon 1994 PCR DNA 1 2 NADH 1 PCR mtdna 2 DNA ND1 347 bp Table 2 2 DNA NDI PCR Primers used for PCR and sequencing of mtdna NDI of Oedaleus asiaticu Primers Sequences Position N1 - J ' - GTAGCATTTTTAACTTTATTAGAACG - 3' N1 - N ' - AAGCTAATCTAACTTCATAAG - 3' PCR 0. 2 ml PCR 2 50 μl DNA 30 ~ 60 ng 10 5 μl Mg μl 25 mmol / L dntp 2. 0 μl 2. 5 mmol / L 2. 0 μl 10 μmol / L TaqDNA 1. 5 U 20 μl DNA DNA ~ min 94 1 min min min min % 1. 5% TAE 300 bp bp DNALadder PCR 4 ~ 5 22 ABI-PRISM % DNA Dnastar Package Edit seq 74. 6% 2 61% Dnastar Package Megalign Clustal W Dnasp ND1 DNA mtdna ND1 mtdna ND1 347 bp % % % 3 A + T 90. 3% 1 A + T A 25. 8% T 50. 8% C 12. 5% G 10. 9% A + T 76. 6% Mega Version A + T 28 Kimura-2- ND1 Parameter NJ UPGMA % GenBank Boot-strap % EU MEGA DNA mtdna ND1 9 2

4 A T A C T C C G F st N m % ~ 0. 18% 2. 2 P < N m 7 mtdna ND1 1 AMOVA % % H H Pi Pi % ~ 1. 68% ~ ~ Table Genetic variation parameters of seven Oedaleus asiaticu populations Parameter Sample size X D H C T A Z Polymophic locus rate Haplotype number ± ± ± ± ± ± ± Hapotype diversity ± ± ± ± ± ± ± Nucleotide diversity Table Genetic divergence and gene flow between seven Oedaleus asiaticu populations Population name X D H C T X D P > H P < P < C P < P < P < T P < P < P < P < A P < P < P < P < P < Z P < P < P < P < P < P < F st P < P < Nm Figures below diagonal represent genetic divergence F st and corresponding significance test of divergence between populations P < means statistical significance P < means extreme significance while figures above diagonal represent gene flow N m between populations. A Z

5 4 mtdna ND1 815

6 Fig mtdna ND1 303 bp 303 bp DNA fragments of mitochondrial ND1 gene of Oedaleus asiaticu and two outgroup species

7 4 mtdna ND UPGMA Ⅲ Ⅳ 1 T-1 1 X-2 NJ 7 28 Boot-strap T-1 Ⅰ Ⅱ 2 Fig. 2 2 ND1 UPGMA NJ UPGMA and NJ tree of mitochondrial ND1 gene of Oedaleus asiaticu and two outgroup species mtdna ND1 347 bp

8 Zhang and Hewitt 1996 Michael et al PCR 378 bp km Cheke NADH ND ~ A + T 76. 6% DNA A + T Crozier and Crozier 1992 Hugall 1997 References 0. 42% ~ 1. 68% ~ mtdna ~ F st ~ Cheke RA A migrant pest in the Sahel the Senegalese P < N m 1 grasshopper Oedaleus enegalensis. Philosophical AMOVA % Transactions of the Royal Society of London. Series B % Biological Sciences Crozier RH Crozier YC The cytochrome b and ATPase genes of homeybee mitochondrial DNA. Mol. Biol. Evol Flook PK Rowll GHF Gellissen G The sequence 2002a organization and evolution of the locusta migratoria 2002b mitochondrial genome. J. Mol. Evol Gray MW Origin and evolution of mitochondrial DNA. Annu. Rev. Cell Biol Oedaleus asiaticus B. - bienko Hugall A Evolution of the AT-rich mitochondrial DNA NADH ND1 of the root knot nematode Meloidogyne hapla. Mol. Biol. Evol Flook et al

9 4 mtdna ND Simon C Frati E Bechenbach A Crespi B Liu H Rlook RE DNA ND Volition weighting and phylogenetic utility of mitochondrial gene sequences and a compilation of mtdna COI. Entomol. Soc. Am Moritz C Dowling TE Brown WM Evolution of animal mitochondrial DNA Relevance for population biology and systematics. Annu. Rev. Ecol. Syst Michael SC Soowon C Felix AHS The current state of in sect molecular systematics A thriving tower of Babel. Annu. Rev. Entomol DNA RAPD mtdna Zhang DX Hewitt GM Nuclear integrations 2002a. Cytb challenges for mito-chondrial DNAmarkers. TREE b. Cytb conserved polymerase chain reaction primers. Ann rRNA DNA...

48 5 ( Pinctada) ( P. fucata ), 3 [ 7 ] ( P. maxima ) ( P. albina), ( P. margaritifera) ( P. nigra) RAPD, ( P. chemnitzi), ( Pteria penguin) [ 1-2 ] [

48 5 ( Pinctada) ( P. fucata ), 3 [ 7 ] ( P. maxima ) ( P. albina), ( P. margaritifera) ( P. nigra) RAPD, ( P. chemnitzi), ( Pteria penguin) [ 1-2 ] [ 5 6 2 00 9 1 2 South China Fisheries Science Vol. 5, No. 6 Dec., 2009 doi: 10. 3969/ j. issn. 1673-2227. 2009. 06. 009 16S rrna,,, (, 510300) : PCR ( Pinctada fucata) ( P. chemnitzi) ( Pteria penguin)