ISSN 1007-7626 CN 11-3870 / Q http / /cjbmb bjmu edu cn Chinese Journal of Biochemistry and Molecular Biology 2015 7 31 7 734 ~ 740 DOI 10 13865 /j cnki cjbmb 2015 07 12 RAW264 7 * 453007 H 2 O 2 RAW264 7 H 2 O 2 RAW264 7 MTT PCR qrt-pcr ELISA RAW264 7 H 2 O 2 40 μmol /L RAW264 7 20 μmol /L 40 μmol /L H 2 O 2 RAW264 7 TNF-α IL-1β MCP-1 MIP-2 200 U /ml H 2 O 2 TNF-α IL-1β MCP-1 MIP-2 H 2 O 2 -α -1β -1-2 Q291 Q786 R392 12 Hydrogen Peroxide Stimulates Expression of Cytokine and Chemokine Genes in Murine RAW264 7 Cells CUI Hai-Yan HAN Chen-Lu XIAO Peng LI Wei-Guo * WANG Kun-Ying College of Life Sciences Henan Normal University Xinxiang 453007 Henan China Abstract Hydrogen peroxide H 2 O 2 as a major form of reactive oxygen species ROS produced from cell respiratory burst functions as signal molecules in promoting the expression of pro-inflammatory cytokine /chemokine genes in macrophage We investigated H 2 O 2 stimulation on the expression of proinflammatory cytokine /chemokine genes in the murine RAW264 7 cells From the results of MTT with qrt-pcr and ELISA assays H 2 O 2 was showed to markedly increase Tnf-α Il-1β Mcp-1 and Mip-2 gene expression at 20 ~ 40 μmol / L without obvious cytotoxicity Catalase treatment at 200 U / ml reduced H 2 O 2 -stimulated expression of the up-mentioned gene These data suggested that H 2 O 2 was an important stimulator regulating the expression of pro-inflammatory cytokines / chemokines in macrophages Key words hydrogen peroxide tumor necrosis factor-α interleukin-1β monocyte chemotactic protein 1 macrophage inflammatory protein 2 macrophages 2015-01-12 2015-04-21 ROS H 2 O 2 ROS No 122102310282 No 2010A180011 * Tel 0373-3328927 E-mail liwg0618@ htu cn Received January 12 2015 Accepted April 21 2015 Supported by Key Program of Science and Technology of Henan Province 1 No 122102310282 Natural Science Basic Research Plan of Educational Bureau of Henan Province No 2010A180011 * Corresponding author Tel 0373-3328927 E-mail liwg0618@ htu cn
7 RAW264 7 735 2 1 -α TNF-α -1β IL-1β -1 monocyte chemotactic protein 1 1 1 MCP-1-2 macrophage DMEM GIBCO inflammatory protein 2 MIP-2 No C1345 3% No TNF-α IL-1β 88597 Sigma-Aldrich 3-4 MCP-1 PCR Real SYBR Mixture with ROX MIP-2 - cdna Genecopoeia PCR 5-6 TNF-α IL-1β MCP-1 MIP-2 ELISA TNF-a IL-1β Long 7 3% H 2 O 2 TNF-α DMEM 100 μmol /L 1 mmol /L ROS Hsu 8 H 2 O 2 DMEM lipopolysaccharides LPS IL-1β ROS Mokgobu 9 - TNF-α IL-1β ROS 10% catalase CAT 100 U /ml 100 μg /ml DMEM GPx H 2 O 2 37 5% CO 2 TNF-a 10 1 3 MTT ROS RAW264 7 1 10 6 /ml MCP-1 100 μl / 96 MIP-2 TNF-a 11 1 25 2 5 5 0 10 20 40 80 12 MCP-1 160 μmol /L H LPS 2 O 2 DMEM 9 12 h 24 h 36 h 48 h MTT NR8383 13 4 h 10 μl MTT RAW 264 7 14 7 4 h DMSO 2 4- DNFB RAW 264 7 Mip-2 15 ROS A 492 % MCP-1 MIP-2 % = 珔 A 16 492 / 珔 A 492 ROS 100% 1 4 H 2 O 2 RAW264 7 RAW264 7 TNF-α IL-1β 1 10 6 /ml MCP-1 MIP-2 3 ml / 6 RAW264 7 3 H 2 O 2 H 2 O 2 10 20 40 μmol /L H 2 O 2 PCR qrt-pcr 200 ELISA H 2 O 2 U /ml 3 TNF-α IL-1β MCP-1 MIP- 2 1 2 RAW264 7 ATCC 150 μl 5 min H 2 O 2 200 U /ml 30 min H 2 O 2
736 31 10 20 40 μmol /L μl dntp 25 mmol /L 1 μl RNase 25 U / 24 h 3 μl 1 μl M-MLV 200 U /μl 1 μl ELISA RNase-free 25 μl RNA qrt-pcr 1 5 RAW264 7 Tnf-α Il-1β Mcp-1 Mip-2 PCR RAW264 7 RNA qrt- PCR 10 μmol /L 0 5 μl cdna 1 PBS 2-3 Trizol μlrnase-free 20 μl qrt-pcr RNA 260 nm 280 nm 95 A RNA 10 min 95 15 s 60 32 s 40 RNA cdna RNA 1 μg Oligo Tnf-α Il-1β Mcp-1 Mip-2 β-actin PCR PCR Primer 5 0 Table 1 qrt-pcr 2 Real SYBR Mixture with ROX 10 μl ABI 7500 Real Time PCR Applied Biosystems USA dt 18 10 μmol /L 1 μl 5 RT 5 2 - ct Table 1 qrt-pcr primer design for mouse Tnf-α Il-1β Mcp-1 Mip-2 and β-actin Primer Primer sequence Product length bp Tnf-α upper primer CTGAACTTCGGGGTGATCGGT Tnf-α lower primer TCCTCCACTTGGTGGTTTGCTAC 158 Il-1β upper primer CAGGCAGGCAGTATCACTCATTGT Il-1β lower primer AACGTCACACACCAGCAGGTTATC 175 Mcp-1 upper primer TCTGCCCTAAGGTCTTCAGCA Mcp-1 lower primer GCATCACAGTCCGAGTCACACTA 287 Mip-2 upper primer TGTCAATGCCTGAAGACCCTGCC Mip-2 lower primer AACTTTTTGACCGCCCTTGAGAGTGG 126 β-actin upper primer CAGGTCATCACTATTGGCAACGAG β-actin lower primer GATGCCACAGGATTCCATACCC 87 1 6 RAW264 7 TNF-α IL-1β MCP-1 MIP-2 ELISA 4 4 000 r /min 10 min TNF-α IL-1β MCP-1 MIP-2 ELISA 2 2 H 2 O 2 RAW264 7 A 450 TNF-α IL-1β MCP-1 MIP-2 1 7 ± means ± qrt-pcr ELISA SD SPSS14 0 RAW264 7 10 ~ 40 μmol /L H 2 O 2 Excel P < 0 05 24 h Tnf-α Il-1β Mcp-1 Mip-2 mrna P < 0 01 Fig 1 RAW264 7 80 μmol /L 160 μmol /L H 2 O 2 24 h RAW264 7 Fig 2 RAW264 7 10 μmol /L 2 H 2 O 2 Tnf-α Il-1β Mcp-1 Mip-2 mrna 2 1 H 2 O 2 RAW264 7 RAW264 7 MTT 0 ~ 160 μmol /L H 2 O 2 20 μmol /L H 2 O 2 Tnf-α Il-1β RAW264 7 Mcp-1 Mip-2 mrna 2 03 RAW264 7 H 2 O 2 40 μmol /L 5 56 2 64 7 07 TNF-α IL-1β MCP-1 24 h MIP-2 953 ng /L 163 ng /L 177 ng /L
7 RAW264 7 737 Fig 1 Effect of hydrogen peroxide H 2 O 2 on murine RAW264 7 cell viability The RAW264 7 cells were incubated with DMEM absence or presence H 2 O 2 0 ~ 160 μmol /L for 24 hours Cell viability were analyzed with MTT method * P < 0 05 and ** P < 0 01 compared to cells in control group 17 82 13 23 14 25 TNF-α IL-1β MCP-1 MIP-2 1975 ng /L 307 ng /L 275 ng /L 133 ng /L 4 45 4 17 3 19 2 39 H 2 O 2 RAW264 7 2 3 H 2 O 2 RAW264 7 TNF-α IL-1β qrt-pcr ELISA 200 U /ml RAW264 7 TNF-α IL-1β 40 μmol /L H 2 O 2 RAW264 7 TNF-α IL-1β RAW264 7 200 U /ml 30 min 40 μmol /L H 2 O 2 24 h 40 μmol /L H 2 O 2 TNF-α 63 3% 56% IL-1β 52% Fig 3 RAW264 7 TNF-α 87 ng /L 2 15 2 21 2 06 IL-1β 1 58 40 μmol /L H 2 O 2 TNF-α IL- H 2 O 2 RAW264 7 TNF-α 1β MCP-1 MIP-2 mrna 5 35 IL-1β 2 4 H 2 O 2 RAW264 7 MCP-1 MIP-2 qrt-pcr ELISA 200 U/mL RAW264 7 Fig 2 Hydrogen peroxide H 2 O 2 stimulates pro-inflammatory cytokine TNF-α and IL-1β and chemokines MCP-1 and MIP-2 expression in murine macrophage RAW264 7 The RAW264 7 cells were incubated with DMEM absence or presence H 2 O 2 10 20 and 40 μmol /L for 24 hours The level of Tnf-α Il-1β Mcp-1 and Mip-2 mrna were tested with qrt-pcr The level of TNF-α IL-1β MCP-1 and MIP-2 were analyzed with ELISA ** P < 0 01 compared to unstimulated cells
738 31 Fig 3 Catalase reduces H 2 O 2 -stimulated the expression and production of cytokines TNF-α and IL-1β in murine macrophage RAW264 7 The RAW264 7 cells were incubated with 200 U /ml catalase CAT 40 μmol /L H 2 O 2 or coincubated with 200 U /ml catalase pretreatmentd for 30 min and 40 μmol /L H 2 O 2 for 24 hours respectively The mrna level of cytokines Tnf-α A and Il-1β C were analyzed with qrt-pcr The secretion of chemokines TNF-α B and IL-1β D were measured with ELISA ** P < 0 01 compared to control group cells ## P < 0 01 compared to H 2 O 2 stimulation group cells MCP-1 MIP-2 40 μmol /L H 2 O 2 H 2 O 2 RAW264 7 MCP-1 MIP-2 TNF-α IL-1β RAW264 7 200 U /ml 30 mins 40 μmol / L H 2 O 2 24 h 40 μmol /L H 2 O 2 ROS TNF-α IL- MCP-1 1β 45% 42% MIP-2 59% 31% Fig 4 NF-κB 17 H 2 O 2 RAW264 7 MCP-1 MIP-2 AP-1 NF-κB 18 H 2 O 2 RAW264 7 MCP-1 MIP-2 MCP-1 MIP-2 1 ROS TNF-α p38 JNK H 2 O 2 - TNF-α IL-1β NF-κB p38mapk 9 ROS 3 NF-κB TLR4 19-20 ROS TNF-α IL-1β MCP-1 MIP-2 H 2 O 2 ROS MCP-1 MIP-2 H 2 O 2 H 2 O 2 Mip-2 mrna
7 RAW264 7 739 Fig 4 Catalase reduces H 2 O 2 - stimulated the expression and production of chemokines MCP-1 and MIP-2 in murine macrophage RAW264 7 The RAW264 7 cells were incubated with 200 U /ml catalase CAT 40 μmol /L H 2 O 2 or coincubated with 200 U /ml catalase pretreatmentd for 30 min and 40 μmol /L H 2 O 2 for 24 hours respectively The mrna level of chemokines Mcp-1 A and Mip-2 C were analyzed with qrt-pcr The secretion of chemokines MCP-1 B and MIP-2 D were measured with ELISA ** P < 0 01 compared to control group cells ## P < 0 01 compared to H 2 O 2 stimulation group cells H 2 O 2 Mip-2 D 16 References H 2 O 2 Mcp-1 Mip-2 extracellular signal-regulated kinase ERK NF-κB AP-1 CREB 21 ROS RAW 264 7 Mip-2 MAPK 15 H 2 O 2 view J RAW264 7 TNF-α IL-1β 4 Stow JL Murray RZ Mcp-1 Mip-2 24 3 227-239 H 2 O 2 TNF-α IL-1β H 2 O 2 Mcp-1 1 Rhee SG Kang SW Jeong W et al Intracellular messenger function of hydrogen peroxide and its regulation by peroxiredoxins J Curr Opin Cell Biol 2005 17 2 183-189 2 Reuter S Gupta SC Chaturvedi MM et al Oxidative stress inflammation and cancer how are they linked J Free Radic Biol Med 2010 49 11 1603-1616 3 Schulte W Bernhagen J Bucala R Cytokines in sepsis potent immunoregulators and potential therapeutic targets-an updated Mediators Inflamm 2013 2013 165974 Intracellular trafficking and secretion of inflammatory cytokines J Cytokine Growth Factor Rev 2013 5 Deshmane SL Kremlev S Amini S et al Monocyte chemoattractant protein-1 MCP-1 an overview J J Interferon Cytokine Res 2009 29 6 313-326 Mip-2 MCP-1 MIP-2 CD49d-dependent manner J H 2 O 2 2548 6 Burdon PC Martin C Rankin SM The CXC chemokine MIP-2 stimulates neutrophil mobilization from the rat bone marrow in a Blood 2005 105 6 2543-7 Long H Shi T Borm PJ et al ROS-mediated TNF-α and MIP- 2 gene expression in alveolar macrophages exposed to pine dust H 2 O 2
740 31 J Part Fibre Toxicol 2004 1 1 3 8 Hsu HY Wen MH Lipopolysaccharide-mediated reactive oxygen species and signal transduction in the regulation of interleukin-1 gene expression J J Biol Chem 2002 277 25 22131-22139 9 Mokgobu MI Cholo MC Anderson R et al Oxidative induction of pro-inflammatory cytokine formation by human monocytederived macrophages following exposure to manganese in vitro J J Immunotoxicol 2015 12 1 98-103 10 Carter AB Tephly LA Venkataraman S et al High levels of catalase and glutathione peroxidase activity dampen H 2 O 2 signaling in human alveolar macrophages J Am J Respir Cell Mol Biol 2004 31 1 43-53 11 Sato M Miyazaki T Nagaya T et al Antioxidants inhibit TNFa mediated stimulation of interleukin-8 monocyte chemoattractant protein-1 and collagenase expression in cultured human synovial cells J J Rheumatol 1996 23 3 432-438 12 Wang JC Zhao Y Chen SJ et al AOPPs induce MCP-1 expression by increasing ROS- mediated activation of the NF-κB pathway in rat mesangial cells inhibition by sesquiterpene lactones J Cell Physiol Biochem 2013 32 6 1867-1877 13 Kopydlowski KM Salkowski CA Cody MJ et al Regulation of macrophage chemokine expression by lipopolysaccharide in vitro and in vivo J J Immunol 1999 163 3 1537-1544 14 Chong IW Lin SR Hwang JJ et al Expression and regulation of macrophage inflammatory protein-2 gene by vanadium in mouse macrophages J Inflammation 2000 24 2 127-139 15 Kim D Kim YJ Seo JN et al 2 4-Dinitrofluorobenzene modifies cellular proteins and induces macrophage inflammatory protein-2 gene expression via reactive oxygen species production in RAW 264 7 cells J Immunol Invest 2009 38 2 132-152 16 Shi MM Chong I Godleski JJ et al Regulation of macrophage inflammatory protein-2 gene expression by oxidative stress in rat alveolar macrophages J Immunology 1999 97 2 309-315 17 Ndengele MM Muscoli C Wang ZQ et al Superoxide potentiates NF-kB activation and modulates endotoxin-induced cytokine production in alveolar macrophages J Shock 2005 23 2 186-193 18 Nakao N Kurokawa T Nonami T et al Hydrogen peroxide induces the production of tumor necrosis factor-alpha in RAW 264 7 macrophage cells via activation of p38 and stress-activated protein kinase J Innate Immun 2008 14 3 190-196 19 Asehnoune K Strassheim D Mitra S et al Involvement of reactive oxygen species in Toll- like receptor 4-dependent activation of NF-kappa B J J Immunol 2004 172 4 2522-2529 20 Lorne E Zmijewski JW Zhao X et al Role of extracellular superoxide in neutrophil activation interactions between xanthine oxidase and TLR4 induce proinflammatory cytokine production J Am J Physiol Cell Physiol 2008 294 4 C985-C993 21 Jaramillo M Olivier M Hydrogen peroxide induces murine macrophage chemokine gene transcription via extracellular signalregulated kinase- and cyclic adenosine 5'-monophosphate camp -dependent pathways involvement of NF-kappa B activator protein 1 and camp response element binding protein J J Immunol 2002 169 12 7026-7038