( ) 33 4 SIENE IN HINA ( Series ) 2003 8 Y DNA * ** ** (- 650091; 650091; 200433; 650031; enter for Genome Information Department of Environmental Health University of incinnati incinnati OH 45267 USA; 674300) 础 6 DNA Y 13 SNP 8 STR Y mtdna DNA Y [1] 1990 15096 [23] [2] ( ) 20 50 [4] 1986 2002-10-10 2003-04-14 * 863(: 2001AA22041)(: 30160037) ** E-mail: cjxiao@publickmyncn; Jin_li@fudanedu
376 ( ) 33 [5~8] 3 : DNA(mtDNA) Y DNA(Y-DNA) X DNA DNA DNA D (HVS1) Y Y [9] Y Y [910] Y (SNPs) [1112] Su [13] 19 Y-SNP 17 [13~19] (STR) Y [2021] [4] 5 ( ) DNA Y 13 SNP 8 STR Y mtdna 1 11 6 3 5 ml AD - DNA 1 Y 1 Y-SNP / M130 YAP M15 M89 M9 M122 M7 M134 M119 M110 M95 M88 M45 H1 H2 H3 H4 H5 H6 H7 H8 H9 H10 H11 H12 H13 50 60 20 40 180 80 40 340 60 120 20 40 50 80 20 100 380 160 100 100 20 40 47 64 234 43 21 319 43 64 128 85 40 25 375 100 25 475 47 21 702 21 43 64 21 64 43 21 50 40 280 80 120 60 40 340 40
4 : Y DNA 377 mtdna Y mtdna ( 5 ) 12 DNA DNA L15996 H16401 PR [22] PR Resin (Promega) 96 Big-Dye (PE ) ABI377 (PE ) 2 ABI Sequence Analysis 33 GenBank () Su [13] 19 Y-SNP 17 YAP M7 M9 M15 M45 M88 M89 M95 M110 M119 M122 M130 M134 13 YAP M15 PR 3% 4% PR-RFLP 11 Y-SNP PR 2 3% New England Biolab 2 Y-SNP PR / PR (5~3) (/bp) YAP 53 M15 56 M89 52 M9 55 M119 55 M95 55 M122 55 M134 55 M7 56 M130 56 M110 55 M88 55 M45 55 AGGGGAAGATAAAGAAATA ATGTAAAAGGGGATGGAT AA AATTGAAAATG GTTGGGAAGAGTAGAGA AAAG GAAAGTGGGGAAGAAGGA GAAATAGGAAAGTGAGAAT GAAAGGTAAGATGGTTGGAT AAATGAATTTTTTTTATTTTTG AGGTAAATGATATAAGGAAG GGGTTATTAATTAGATAAG ATAAGGAAAGATAATATTAGG TTTGAAGGAGTTGTGAG TAGAAAAGAATTGAGATATAATTA GGATGTGATATGTAGTTAG AAGGAAGGAAAGTATGATG TTTGATGATTTTTTTGGGTT TGTATTGAAATGTT TTGTAGTTGAGTTATGTTTTTA TATTTTTTATTGAG AAAGGGGGAAAAAAA AAATTTTGTAGATATGG ATTTAGATTTTTT TTTATTTGTTTTG ATGTGATGGTTAGTAGGTGTGA ATTGGAGTGAAAAATTATAGTA TGTTTGTAAATTTA / / Nla BamH Bstu Hha Nla Nla Bfa Bsl Nla Bstu Bfa Alu (150) 9 bp (151) (79+21) (190+20) A (161) (178+24) (100+22) (100+22) (103+23) T (205) T (200) A (146) G (140+22) Alu (400) (142) T (100) G (210) (135+26) T (202) T (122) 1bp (122) G (126) (162+43) (88+122) G (125+21) DYS19 388 389-1 389-2 390 391 392 393 8 Y STR GDB (http://wwwgdborg) 6-FAM(388 A (162)
378 ( ) 33 389) NED(390 392 393) HEX(19 392) 8 2 (Panel) PR [21] 05 礚 PR 02 礚 ROX-500 (PE ) 18 礚 95 2 min ABI 377 4% 2 h Genescan TM 20(PE ) DNA Genotype TM 11 (PE ) 13 360 bp (16024~16383) mtdna lustalw [23] ARLEQUIN [24] Fst d [25] A Fst 3000 1 Yao [26] mtdna Y-SNP [13] Y-STR ARLEQUIN Rst [27] 3000 Y-SNP mtdna (MDS) () SPSS (NJ) MEGA2 [28] Y-SNP [15] [18] [18] [14] [14] [19] mtdna HVS1 [26] [26] [26] [26] [29] [29] [30] [30] [30] [30] [30] 2 21 Y-SNP mtdna 1 6 Y-SNP 6 10 9 8 5 H5 H2 H8 68% 74% H2(702%) H11 (475%) H11 239 177 mtdna HVS1 5 3 2 87%( 3) B D F M7 1 B D F 738% B F F G A D ( ) 22 Y-STR Rst ( 4) Rst P 005
4 : Y DNA 379 3 mtdna 1 mtdna a) a) a) a) (43) (50) (47) (69) (37) (46) (45) (35) (36) (40) A 47 40 106 54 43 89 143 139 195 B* 23 20 B4 117 100 21 290 130 178 29 56 122 B5* 54 B5a 47 43 174 66 111 B5b 23 21 14 B 210 120 85 304 54 304 244 29 167 122 47 64 130 89 229 83 24 D4k 93 260 191 101 108 130 67 171 194 146 D5* 23 39 21 58 D5a 23 60 43 87 57 56 24 D 139 359 255 159 108 217 67 228 250 170 F* 23 21 14 F1a 116 40 43 174 162 178 29 49 F1b 47 40 21 14 54 174 44 29 49 F1c 20 21 14 27 F2* 29 F2a 23 20 43 14 81 43 22 57 28 24 F 209 120 149 259 324 217 244 115 28 122 G2 60 21 14 108 22 24 M10 23 20 29 81 89 29 28 98 M7* 23 21 14 M7B 163 40 64 87 54 22 122 M7c 21 14 M7 186 40 106 115 54 22 122 M8a 80 43 29 M9 40 43 00 54 57 56 73 N9a 70 60 14 R9a 23 43 14 22 Y 20 21 Z 21 28 b) 46 40 42 57 162 86 111 171 25 49 a) [26] ; b) M* N* R*; * 4 Y-STR Rst a) 0003 0012 0000 0000 0005 0048 0001 0000 0000 0009 0043 0076 0000 0000 0101 0260 0191 0138 0003 0006 0410 0334 0238 0111 0000 0065 0057 0021 0084 0193 a) Rst P mtdna 1 Fst d A ( 5) (r = 0947 P < 001)
380 ( ) 33 Fst Fst 5 mtdna 1 Fst (d A ) a) 1 2 3 4 5 6 7 8 9 10 11 12 13 14 1 0845 0313 0451 0499 0196 0264 0199 0269 0349 0497 0508 0188 0529 2 0079 0211 0779 0515 0492 0441 1329 0517 0504 1045 0312 0687 1131 3 0031 0019 0569 0353 0203 0108 0630 0201 0214 0572 0137 0263 0572 4 0052 0071 0054 0438 0305 0661 0939 0680 0445 0660 0927 0376 0504 5 0057 0048 0034 0048 0273 0514 1162 0481 0271 0642 0540 0394 0624 6 0022 0046 0020 0033 0030 0215 0702 0282 0049 0250 0400 0140 0579 7 0032 0043 0011 0073 0058 0024 0486-0019 0145 0545-0012 0245 0685 8 0028 0130 0068 0117 0141 0086 0064 0541 0722 0976 0783 0584 0965 9 0035 0058 0025 0082 0060 0036-0002 0072 0217 0573 0019 0229 0580 10 0045 0050 0022 0055 0034 0006 0018 0105 0029 0275 0242 0098 0426 11 0059 0085 0046 0072 0070 0022 0061 0147 0070 0039 0766 0211 0605 12 0062 0031 0014 0104 0063 0046-0002 0106 0003 0033 0093 0380 0874 13 0026 0071 0030 0049 0050 0018 0032 0086 0031 0014 0029 0051 0195 14 0069 0108 0059 0063 0076 0068 0084 0141 0075 0062 0089 0111 0029 a) Fst Fst P > 005 Y-STR mtdna (r = 0298 P = 028) 23 1 Y-SNP 3 703% 14 4 : A ; B ; ; D 5 ( A ) H2 (r = 0844 P < 001) 1 Y-SNP ( 3 H2 704%) A D H8 (r = 0810 P < 001) H11 (r = 0898 P < 001) H2 H8 H8 H11
4 : Y DNA 381 mtdna B D F M7 2 765% 2 2 mtdna F (r = 0799 P < 001) B (r = 0654 P < 005) A (r = 0667 P < 005); D (r = 0721 P < 005) F (r = 0876 P < 001) 4 B F D 5 Fst ( 3) 754% 2 3 24 3 mtdna Fst 4 Y-STR Rst mtdna Fst 3 Y H2 H5 H8 YAP+(H2 H3) H8 [15] YAP+ H8 Y (r = 0642 P < 005) M95 H11 M119 H9
382 ( ) 33 85% H9 ; H11 (475%) 4 YSTR R st ((a))(mds) (NJ)((b)) Y-STR B F D mtdna B F [2631] B F 2 (r = 0827 P < 001) D F (r = 0785 P < 005) ([26] 4 ) D mtdna 5 mtdna 1 Fst : () Y (mtdna) Y-STR mtdna HVS1 [3233] 7 [34]
4 : Y DNA 383 础 [35] : () ; () [34] [4] 75% () 600 [36] [4] [37] 1 Gottner-Abendroth H The structure of matriarchal societies ReVision 1999 21(3): 31~35 2 : 1997 19~29 3 1999 (5): 60~62 4 1998 10(1): 89~95 5 ann R L Stoneking M Willson A Mitochondrial DNA and human evolution Nature 1987 325: 31~36 6 avalli-sforza L Menozzi P Piazza A The history and geography of human genes Princeton: Princeton University Press 1994 373~374 7 avalli-sforza L et al 2000 30(4): 434~442 8 avalli-sforza L et al 38 1998 28(1): 83~89 9 Jobling M A Tyler-Smith Father and sons: the Y chromosome and human evolution Trends Genet 1995 11: 449~456 10 Underhill P A Passarino G Lin A A et al The phylogeography of Y chromosome binary haplotypes and the origins of modern human populations Ann Hum Genet 2001 65(1): 43~62 11 Underhill P A Shen P Lin A A et al Y chromosome sequence variation and the history of human populations Nature Genetics 2000 26: 358~361
384 ( ) 33 12 Su B Xiao Deka R et al Y chromosome haplotypes reveal prehistorical migrations to the Himalayas Human Genetics 2000 107: 582~590 13 Su B Xiao J Underhill P et al Y chromosome Evidence for a northward migration of modern humans in East Asia during the last Ice Age American Journal of Human Genetics 1999 (3)65: 1718~1724 14 Li Jin Bing Su Natives or immigartions: modern huamn orgin in East Asia Nature Genetics Reviews 2000 (1): 126~132 15 Qian Y Qian B Su B et al Multiple origins of Tibetan Y chromosomes Human Genetics 2000 106: 453~454 16 Su B Jin L Underhill P et al Polynesian origins: new insights from the Y-chromosome Proceedings of National Academy of Sciences USA 2000 97: 8225~8228 17 Ke Y H Su B Song X F et al African origin of modern humans in East Asia: A tale of 12000 Y chromosomes Science 2001 292: 1151~1153 18 Y 2000 30(6): 614~620 19 : Y 2002 29(2): 196~200 20 Kayser M aglia A orach D et al Evaluation of Y-chromosomal STRs: a multicenter study Int J Legal Med 1997 110(3): 125~133 21 Kayser M Krawczak M Excoffier L et al An extensive analysis of Y-chromosomal microsatellite haplotypes in globally dispersed human populations Am J Hum Genet 2001 68(4): 990~1018 22 Lum J K ann R L Martinson J J et al Mitochondrial and nuclear genetic relationships among Pacific Island and Asian populations Am J Hum Genet 1998 63(2): 613~624 23 Anderson S Bankier A T Barrell B G et al Sequnence and organization of the human mitchondrial genome Nature 1981 290: 457~465 24 Schneider S Roessli D Excoffier L Arlequin ver 20: A Software for Population Genetic Data Analysis Switzerland: University of Geneva 2000 25 Nei M Kumar S Molecular evolution and phylogenetics New York : Oxford University Press 2000 256 26 Yao Y G Kong Q P Bandelt H J et al Phylogeographic differentiation of mitochondrial DNA in Han hinese Am J Hum Genet 2002 70(3): 635~651 27 Slatkin M A new measure of population subdivision based om microsatellite allele frequencies Genetics 1995 139: 457~462 28 Sudhir Kumar Koichiro Tamura Ingrid B et al MEGA2: Molecular Evolutionary Genetics Analysis Software Arizona: Arizona State University Tempe 2001 29 Yao Y G Lu X M Luo H R et al Gene admixture in the silk road region of hina: evidence from mtdna and melanocortin 1 receptor polymorphism Genes Genet Syst 2000 75(4): 173~178 30 Yao Y G Nie L Harpending H et al Genetic relationship of hinese ethnic populations revealed by mtdna sequence diversity Am J Phys Anthropol 2002 118(1): 63~76 31 Wallace D Brown M D Lott M T Mitochondrial DNA variation in human evolution and disease Gene 1999 238(1): 211~230 32 Gibbons A The women's movement Science 1997 278: 805 33 Elizabeth Pennisi Tracking the sexes by their genes Science 2001 291: 1733~1734 34 : 1997 10~24 35 : 1994 289~291 36 1995 (1): 27~32 37 : 1996 315~320