6 3 2 0 1 0 6 South China Fisheries Science Vol. 6, No. 3 Jun., 2010 doi: 10. 3969/ j. issn. 1673-2227. 2010. 03. 010 1 1, 2, 1 1 1,,, 1 ( 1.,, 510640; 2., 510642) : cdna ( rapid amplification of cdna ends, RACE), ( Oreochromis niloticus) 1 ( glutathione peroxidase1, GPx1) ( complete coding se- quence, CDS) GPx1 984 bp, 5 UTR 56 bp, CDS 576 bp, 3 UTR 352 bp, PolyA 20 bp; 791 885 ( 3 UTR) TGA ( UGA) 1 ( selenocysteine insertion sequence, SECIS), 174 176 1 ( Sec) GPx1 191, 21. 8 kda, 8. 04, N-, GPx1 SecTrpGlnAsn GPx1 GPx1, 43. 2% 58. 2%, 58. 1% 80. 6%, GPx1 Swiss-Model GPx1 3D,, GPx1 1 : ; 1; : Q 785 : A : 1673-2227 - ( 2010) 03-0052 - 06 Molecular cloning and characterization analysis of glutathione peroxidase 1 from Nile tilapia ( Oreochromis niloticus) CAO Yanlin 1, 2, KE Hao 1, LIU Zhenxing 1, ZHANG Jianfei 1, LIN Min 1 ( 1. Guangdong Public Lab. of Veterinary Public Health, Institute of Veterinary Medicine, Guangdong Academy of Agricultural Sciences, Guangzhou 510640, China; 2. College of Life Sciences, South China Agricultural University, Guangzhou 510642, China) Abstract: The complete coding sequence of glutathione peroxidase 1 ( GPx1) of Nile tilapia ( Oreochromis niloticus) rapid amplification of cdna ends ( RACE). was cloned by The GPx1 contains 984 bp, including a56 bp 5 -untranslated region, a 576 bp coding sequence ( CDS), a 352 bp 3 -untranslated region and a 20 bp PolyA tail. A selenocysteine ( Sec) was encoded by the unusual stop codon, TGA, with the selenocysteine insertion sequence ( SECIS) located at 3 UTR. The GPx1 was predicted to encode 191 amino acids, and its molecular weight was 21. 8 kda with a pi of 8. 04; neither signal peptide nor N-Glycosylation site was found. The analysis showed that GPx1 was a non-transmembrane protein, and it possessed classic catalytic tetrad comprising selenocysteine, tryptophan, glutamine and asparagine. We compared GPx1 between Nile tilapia and other vertebrate animals, and found that the similarity of nucleotide acid sequence was 43. 2% 58. 2%, and that of amino acid sequence was 58. 1% 80. 6%. Phylogenic analysis indicated that GPx1s of different classes of vertebrates split into different clusters. The 3D structure of tilapia GPx1 was predicted with Swiss-Model : 2010-03-22; : 2010-04 -13 : ( 2006D90204008) ; ( 2008B020700006) : ( 1983 - ),,, E-mail: yanlincao@ yahoo. cn :, E-mail: keha@ tom. com
3 : 1 53 software, and sequence analysis suggested that GPx1 was homotetrameric. Key words: Oreochromis niloticus; glutathione peroxidase1; gene cloning GPx) ( glutathione peroxidase,, 1. 2, 1 1. 2. 1 cdna 0. 01% H 2 O 2 ( Sec), ( reactive oxygen, GPx 0. 5 h species, ROS),,, Trizol RNA, Prime- ( SOD) Script cdna, cd- [ 1-2] ( CAT) NA GPx, 1. 2. 2 GPx1 [ 3-4], GPx GPx1, Oligo 6. 0 [ 5-7 ] GPXS1 / GPXR1 ( 1),, [ 8-9] GPx, GPx1, PCR ( biomarker) : 94 2 min, 94 30 s, 50 30 s, ( Danio rerio) 72 1 min, 35, 72 10 minpcr GPx1, ( Thunnus maccoyii) GPx1,, pmd18-t ( Oplegnathus fasiatus) GPx1, ( Ctenopharyngodon idella) GPx1, ( Anguilla japonica) GPx1 ( complete coding sequence, CDS) GPx, 1 GPx1 [ 10-11] GPx, ( 5 3 ), GPx primer sequence ( 5 3 ) [ 12-1 3] ( Oreochromis niloticus) GPXS1 GPXR1 CAGTTYGGCCAYCARGA AGRAACTTYTCRAARTTCCA LGPXS2 AGAAGGTGGATGTGAATGGA, LGPXS3 TGATGCCCTGGGTCTCAT, GPx CDS LGPXR2 TATCTGCCTCGATGTCACTTGTC RT-PCR LGPXR3 AGTTCCAGGATACGTCATTC RACE FAP GGCCACGCGTCGACTAGTAC17 ( GPx1),, RAP GGCCACGCGTCGACTAGTACT17 AP GGCCACGCGTCGACTAGTAC GPx1 1 1. 1 1. 1. 1, 80 100 g,, : 94 2 min, 94 30 s, 52 1. 1. 2 Trizol Invitrogen, cdna Taq TdT, LGPXS3 / AP, pmd18-t SYBR green premix TaKaRa, PCR Axy- 30 s, 72 1 min, 35, 72 10 min gen, TOP10 cdna, Top10, Tab. 1 : Y. C/T; R. A /G Primers used in GPx1 cloning 1. 2. 3 GPx 3 RACE, Oligo 6. 0 LGPXS2 LGPXS3, RAP AP ( 1) cdna, LGPXS2 / RAP 30 s, 72 1 min, 35, 72 10 min : 94 2 min, 94 30 s, 57
54 6 1. 2. 2 1. 2. 4 GPx 5 RACE 3 LGPXR2 LGPXR3, FAP ( 1) cdna, polyg,, FAP/ LGPXR2, : 94 2 min, 94 30 s, 60 30 s, 72 1 min, 35, 72 10 min, AP/LGPXR3, : 94 2 min, 94 30 s, 55 30 s, 72 1 min, 35, 72 10 min 1. 2. 2 1. 2. 5 GPx1 SE- CISearchDNA Star ClustalXMEGA 4. 0SignalP 3. 0ProtScaleNetNGlycPSORTTMHMM Swiss-Model GPx1 cdna 2. 1 GPx1 GPx complete CDS GenBank, GQ853451 Anguilla japonica 51. 5 78. 5 2. 2 GPx1 2. 2. 1 GPx1 cdna Thunnus maccoyii 54. 6 73. 1 GPx1 984 bp, 5 UTR 56 bp, CDS 576 bp, 3 UTR 352 bp, PolyA 20 bp; 174 176 TGA ( UGA ) ( Sec) ; 791 885 ( 3 UTR) 1 Mus musculus 44. 1 63. 2 1 ( selenocysteine insertion sequence, SECIS) ( 1) GPx1 191, 21. 8 kda, 8. 04SignalP 3. 0 NetNGlyc, GPx1 ( 2) N- 2. 2. 3 GPx1 ProtScalePSORT TMHMM GPx1, GPx1 GPx1 SecTrpGln, Aln 4, 2. 2. 2 GPx1 ( oligomerization GPx1 loop) PGGG ( PGGGmotif) 43. 2% 58. 2%, 58. 1% 3), GPx1 80. 6% ( 2) GPx1 PGGG ( 4) 2 Tab. 2 Fig. 1 1 GPx1 SECIS SECIS of O. niloticus GPx1 GPx1 Comparison of nucleotide and amino acid similarities between O. niloticus GPx1 and other vertebrate animals GPx1 % 2 species nucleotide similarity amino acid similarity Ctenopharyngodon idella 58. 2 80. 6 Danio rerio 56. 6 78. 5 Homo sapiens 45. 2 63. 8 Equus caballus 43. 9 64. 3 Xenopus ( Silurana) tropicalis 44. 0 58. 4 Taeniopygia guttata 43. 2 58. 1, 3D, GPx1 (
3 : 1 55 Fig. 2 2 GPx1 20 NJ Phylogentic tree of 20 species of vertebrate animals based on complete sequence of GPx1 gene 3 Swiss-model GPx1 3D Fig. 3 O. niloticus GPx1 3D model predicted with Swiss-model 3 ( Sec) 21,, 1 GPx UGA, Sec t-rna mrna 3 UTR ( selenocysteine insertion sequence, SECIS), trna UGA [ 14] GPx1 1 UGA, 3 UTR SECIS ( 1), 1 Sec GPx, ( Cys) ( Sec) TrpGln Asn ( N-H), [ 3] GPx GPx1 ( 3, 4) GPx, Arg5298179 180 Lys86 GPx [ 1 5] GPx 3,, [ 16 ] GPx1 ( 3) [ 17 ] PGGG [ 5] GPx1 2 ( 3, 4),
56 6
3 : 1 57, GPx1,, A2 GPx1 [ 18-2 0], GPx1 Myxosporea) [ 4], GPx1 [ 2 1], GPx1, N-, : carp and grass carp [ J]. BMB Rep, 2008, 41 ( 3) : 204-209. [ 10] ISRA S, NIYOGI S. Selenite causes cytotoxicity in rainbow trout ( Oncorhynchus mykiss) hepatocytes by inducing oxidative stress [ J]. Toxicol In Vitro, 2009, 23 ( 7 ) : 1249-1258. [ 11] SITJ-BOBADILLA A, CALDUCH-GINER J, SAERA-VILA A, et al. Chronic exposure to the parasite Enteromyxum leei ( Myxozoa: modulates the immune response and the expression of growth, redox and immune relevant genes in gilthead sea bream, Sparus aurata L [ J]. Fish Shellfish Immunol, 2008, 24 ( 5 ) : 610-619. [ 12] CHOI C Y, AN K W, NELSON E R, et al. Cadmium affects the expression of metallothionein ( MT ) and glutathione peroxidase ( GPX) mrna in goldfish, Carassius auratus [ J]. Comp Biochem Physiol Part C: Toxicol Pharmacol, 2007, 145 ( 4 ) : 595 [ 1] ASSARDI F, THEILER G, ZAMOCKY M, et al. PeroxiBase: the peroxidase database [ J]. Phytochem, 2007, 68 ( 12 ) : 1605 - a marine medaka ( Oryzias javanicus) exposed to organophosphorus 1611. pesticide [ J]. Comp Biochem Physiol C: Toxicol Pharmacol, 2009, [ 2]. [ J]. 149 ( 3) : 427-432., 2005, 21 ( 5) : 369-371. [ 14] KOROTKOV K V, NOVOSELOV S V, HATFIELD D L, et al. [ 3] TOSATTO S C, BOSELLO V, FOGOLARI F, et al. The catalytic Mammalian selenoprotein in which selenocysteine ( Sec) incorporation site of glutathione peroxidases [ J]. Antioxid Redox Signal, 2008, is supported by a new form of Sec insertion sequence element 10 ( 9 ) : 1515-1525. [ J]. Mol Cell Biol, 2002, 22 ( 5) : 1402-1411. [ 4] TOPPO S, FLOHL, URSINI F, et al. Catalytic mechanisms and specificities of glutathione peroxidases: variations of a basic scheme [ 15],,,. cdna [ J]., [ J]. Biochimica et Biophysica Acta ( BBA) - General Subjects, 2007, 42 ( 3 ) : 40-47. 2009, 1790 ( 11) : 1486-1500. [ 5] TOPPO S, VANIN S, BOSELLO V, et al. Evolutionary and structural [ 16] FUKUHARA R, KAGEYAMA T. Structure, gene expression, and evolution of primate glutathione peroxidases [ J]. Comp Biochem insights into the multifaceted glutathione peroxidase ( Gpx) su- Physiol B: Biochem Mol Biol, 2005, 141 ( 4) : 428-436. perfamily [ J]. Antioxid Redox Signal, 2008, 10 ( 9 ) : 1501 - [ 17] EPP O, LADENSTEIN R, WENDEL A. The refined structure of 1513. the selenoenzyme glutathione peroxidase at 0. 2-nm resolution [ 6] CONRAD M, SCHNEIDER M, SEILER A, et al. Physiological role [ J]. Eur J Biochem, 1983, 133 ( 1) : 51-69. of phospholipid hydroperoxide glutathione peroxidase in mammals [ 18] ARTHUR J R. The glutathione peroxidases [ J]. Cell Mol Life [ J]. Biol Chem, 2007, 388 ( 10) : 1019-1025. Sci, 2000, 57 ( 13 /14) : 1825-1835. [ 7] MARGIS R, DUNAND C, TEIXEIRA F K, et al. Glutathione peroxidase [ 19 ] GROSSMANN A, WENDEL A. Non-reactivity of the selenoenzyme family: an evolutionary overview [ J]. FEBS J, 2008, glutathione peroxidase with enzymatically hydroperoxidized phospholipids 275 ( 15 ) : 3959-3970. [ J]. Eur J Biochem, 1983, 135 ( 3 ) : 549-552. [ 8] LIU C H, TSENG M C, CHENG W. Identification and cloning of [ 20] SEVANIAN A, MUAKKASSAH-KELLY S F, MONTESTRUQUE the antioxidant enzyme, glutathione peroxidase, of white shrimp, S. The influence of phospholipase A2 and glutathione peroxidase Litopenaeus vannamei, and its expression following Vibrio alginolyticus on the elimination of membrane lipid peroxides [ J]. Arch Biochem infection [ J]. Fish Shellfish Immuol, 2007, 23 ( 1 ) : 34 - Biophys, 1983, 223 ( 2) : 441-452. 45. [ 21] HERBETTE S, ROECKEL-DREVET P, DREVET JR. Seleno-independent [ 9] LI G Z, LIANG X F, YAO W, et al. Molecular characterization of glutathione peroxidases. More than simple antioxidant glutathione peroxidase gene from the liver of silver carp, bighead scavengers [ J]. FEBS J, 2007, 274 ( 9) : 2163-2180. - 600. [ 13] WOO S, YUM S, KIM D W, et al. Transcripts level responses in