H 2 PCR 71 PCR pz-55 L8-3 pal618 PCR hup

Size: px

Start display at page:

Download "H 2 PCR 71 PCR pz-55 L8-3 pal618 PCR hup"

以胥
5 years ago
Views:

1 UDC

2 H 2 PCR 71 PCR pz-55 L8-3 pal618 PCR hup

3 pbluescript KS + DNA Dig-11-dUTP hup DNA hup pz-55 BamH EcoR Kpn pz-55 pz-55 EcoR pz-55 Southern DNA pz kb EcoR pz-55 Tc r Ln-1 Hup - Ap r So-3 Hup - Ap r M-5 Hup - Ap r EL-55 Hup + Ap r Tc r Sz-55 Hup + Ap r Tc r Mz-55 Hup + Ap r Tc r PZ % hup 80% N 2 ase N 2 N 2 2 NH 3 H 2 N 2 ase N 2 +8e - +8H + +16ATP 2NH 3 +H 2 +16ADP+16Pi

4 Hup + Hup kb Friedman 1982 (cosmid)plafr1, Tc r, EcoR 15-31kb DNA Ecoli prk2013 plafr1 G - plafr1 Hup Staskawics 1987 puc8 Hae plarf1, Hup plarf3 Cantrell 1983 plafr1

5 hup Haugland 1984 phu52 Lambert (1985) Sayavedra-Soto 1988 HupS, HupL HUM Maier et al, 1978 Lambert 1987 phu52 5.5kb EcoR Soom1993 9kb (ORFs) (hypd, hype, hoxx, hoxa), hypd Fe-S Durnowicz 1997 HoxX 60~70% HoxX HoxA HoxA HoxX HoxA HupSL 158bpDNA HoxA Soom 1993a 1993b hups hupl hupc hupd hupf hupcdf hupg, huph, hupi, hupj, hupk, hypa, hypb Fu 1994 hupn hupo hupp Ni Black 1994 hupslcdf hupu hupv 35.4KD 51.8KD HupS HupL Ni Ni 1kb 1. Fig. 1. Genetic and physical maps of the hup gene clustere in Bradyrhizobium japonicum

6 E, EcoR B, BamH ; Bg, Bgl ; H, Hind hup Brewin 1980 Leyva 1987 Leyva 1987 hup pal618 pal618 21kb DNA 15kb Tn5 Palacios 1988 pal618 Hup pal618 NB2 14 1~2 hup hup ~ Leyva 1990 Hup / hupl, hups hupc, hupd, hupe, hupf Schneider 1990 hupsl Hidalgo 1992 hupc b- HupD hupe hupf Hup / hupg, huph, hupi, hupj, hupk, 3.2kb hup Luis 1992 hup / hypa hypb hypf hypc hypd hype Ni Palacios Ruiz-Argeso 1997 nif gene fnrn hupsl nifa nif, hup 1 HupL HupS 74%

7 1. B.j, R.c, A.v, A.c, E.c Table 1. Sequence comprison of R. Leguminosarum uptake hydrogenase small subunit and large subunit with comparable sequence from B.japonicum, R. Capsulatus, A. Vinelandii, A.chroococcum and E.coli. Strains Hup L Hup S reference B. japonicum 89.3% 89.4% Sayavedra-soto et al, 1988 R. Capsulatus 76.2% 74.6% Leclerc et al, 1988 A. Vinelandii 79.8% 58.6% Menon, et al, 1990 A. chroococcum 75.8% 64.6% Ford et al, 1990 E. coli 68.0% 63.5% Menon, 1990 hup H 2 ase H 2 ase HupS 83.1% HupL 89.4% hup DNA 3~4 10% 1/3~2/ L8-3 CO

8 65KD 35KD H 2 H 2 cytb cytc cyta L8-3 cosmid plafr PCR hup 1997 Hup - Ln-1 Ap r Ap r Tc r EL-55 EL-60 hup DNA 2 2. Table 2. Bacterial strains and plasmids

9 Strain or plasmid Relevant characteristic Source or reference Strains R.arachis L8-3 Nif + Hup + Ap r R.arachis So-3 Nif + Hup Ap r This lab R.arachis Ln-1 Nif + Hup Ap r This lab R.japonicum M-5 Nif + Hup Ap r This lab R.arachis El-55 Nif + Hup + Ap r Tc r This lab R.arachis El-60 Nif + Hup + Ap r Tc r This lab R.arachis Sz-55 Nif + Hup + Ap r Tc r This lab R.arachis Sz-60 Nif + Hup + Ap r Tc r This lab R.japonicum Mz-5 Nif + Hup + Ap r Tc r This lab Plasmids pbluescript Ks(+) phagemid Ap r PLAFR 3 cos Tc r Staskanicz(1987) prk2013 tra Km r Ditta (1980) pal618 plafr1 containing Hup-fragment Leyva (1987) pz 1-71 plafr3 containing Hup-fragment This lab 1. YEM J.M. (1970) 2. TY 5g 3g CaCl 2.2H 2 O 0.93g %( ); 1000ml ph L B HUM SDS( ) NaCl MgSO 4 7H 2 O Na 2 HPO 4 NaOAc NH 4 OAc KOAc ; 2 Unipath Promega

10 Tris Promega EDTA-Na 2 ICN DNA Marker T4 DNA Taq DNA X-gal IPTG Dig High Prime Labeling and Detection Starter Kit Cat.No Solusion 50 mmol/l Tris-HCl 25 mmol/l ph8.0 EDTA 10 mmol/l ph8.0 Solusion NaOH 0.2 mmol/l SDS 1% ( ) Solusion KOAc(5mmol/L) 60 ml 11.5 ml ddh 2 O 28.5 ml TE 1 Tris-HCl 10 mmol/l ph8.0 EDTA 1 mmol/l ph8.0 STE TE 1 ph8.0 NaCl 0.1 mol/l : 10% SDS; 10mol/L NaOH; 0.5mol/L EDTA(pH8.0); 3mol/L NaAc; 5mol/L NaCl 10% Sarcosyl 2 DNA 1mol/L Tris-HCl( ph8.0); TE 2 : Tris-HCl 50 mmol/l ph8.0 EDTA 0.1 mol/l ph8.0 3 NaOH 3% w/v Goa(1953) 4 1% w/v Benedict : 20 mg/ml -20 o C RNase A: 10 mmol/l Tris-HCl (ph7.8)- 15mmol/L NaCl, 20mg/ml 30 min -20 o C 100 o C Pronase E: 10 mmol/l Tris-HCl (ph7.5)-10mmol/l NaCl, 20 mg/ml 37 o C 1 h, -20 o C

11 5 ; ; 20 mg/ml, 10 mg/ml 0.22um, -20 o C 6 : TAE(50 EDTA (ph8.0) ): 242g Tris, 57.1g, 100 ml 0.5mol/L 1 L %, 40%( w/v), 4 o C :24: %, 4 o C 9 DNA a. Buffer 1: 0.1mol/L 0.15mol/L NaCl, NaOH ph 7.5 b. Buffer 2: DIG 10 blocking c. Buffer 3:0.1mol/L Tris-HCl, 0.1mol/L NaCl, 50mmol/L MgCl 2 ph9.5 d anti-digoxigenin-ap buffer2 e. 200 ul NBT/BCIP 10 ml buffer 3 f. 5 SSC, 0.1%(W/V)N-lauroylsurcosine, 0.02%SDS, 1 blocking g. 2 SSC, 0.5%SDS h. 2 SSC, 0.1%SDS i. 0.1 SSC, 0.1%SDS j. : 1.5mol/L NaCl, 0.5mol/L NaOH k. : 1.0mol/L Tris-HCl( ph8.0), 1.5mol/L NaCl ZFP ZF-A1

12 LG LSJ- DYY G 103 PCR DNA PE 480 SHZ-22 DNA 1. 20ml TY AP 50ug/ml, 28 24h 2. 10ml 10000rpm 5min STE 0.9ml TE ul 10mg/ml 1mg/ml, 37 30min 4. 20mg/ml Pronase K 50ul, 1mg/ml, RNase 100ug/ml, 0.1ml 10% Sarcosyl 0.1ml 10% Sarcosyl 37 30min 5. 30s, 5min 15000rpm 5min mol/L NaOAc 0.3mol/L min rpm 15min DNA 100ul TE % 1. (E.coli HB101 pz1-71) 20ml LB Tc 30 ug/ml 37 o C 16h 2. 10ml 4 o C 10 min 15000rpm 30s 2ml STE ul Solusion 4. Solusion 1.2ml (ph12.6 ) 10 min ul Solusion 15min 2h 15000rpm RNase(10mg/ml)15ul, 37 o C30min - -

13 10000rpm 2min 6. 3mol/L NaOAc 0.3mol/L min rpm 15min DNA 0.5ml 70% 100ul, -20 o C hups hupl hups hupl A B A 5 AGGACGCGATGGCGATCATC 3 B 5 GGATCGACGACGATGCG 3 PCR 34 ul 10 buffer 5 ul d NTP 2mmol/L each 5 ul A 8.3umol/L 2ul B 8.3umol/L 2ul DNA 100ul. PCR : 94 8 min 52 30s 72 1min : 94 30s 52 30s 72 40s (34 ) : 94 30s 52 30s 72 10min 1ul 10min, 1.2u DNA. PCR, 4. 5ul 1. pal pluesript KS + 3. DNA DNA 1 4~6U 6~8U 37 3h 0.5mol/L EDTA

14 ph8.0 10mmol/L 20 4 DNA 1 TAE 0.8% EB 0.5ug/ml 0.8% EB 4 2h 2 DNA 50ul 5V/cm, 2h 3 DNA 1.5ml Eppendorf 400ul 65 5min - - 3mol/L NaOAc 0.3mol/L 2 1min 15000rpm 15min 70% 5min 20ul 5 1 DNA ddh 2 O 8ul 10 buffer 1ul 5U ligase 16 4h 2 4ml LB DH ml 50ml LB 37 OD min 5000rpm 5min 4ml 50mmol/L CaCl 2 30min rpm 5min 2ml 50mmol/L CaCl 2 0.2ml h DNA 4 5ul DNA 30min s 1ml LB 37 45min 6 1ul 1mol/L IPTG 40ul 20mg/ml X-gal 7 200ul LB Ap 100ug/L LB

15 Ap100ug/L 37 2 a. 3ml 15000rpm 20s 300ul Solution Solution 5min b rpm 10min 200ul Solution 5min RNase A 50ug/ml min 250ul c. 400ul 100% 10min 12000rpm d. 70% 5min 30ul ddh 2 O 3 PCR 1 DNA The DIG System User s Guide for Filter Hybirdization 20 1 DNA 3.0kb 2 1ug DNA 16ul 3 10min 4 4ul Dig-High Prime( dntp, DIG-11-dUTP, Klanow h buffer), 6 2ul 0.2 mol/l EDTA(pH 8.0) 2 DIG DIG 1 DNA DNA 1ug/ml 2 Dilution steps Dilution in DNA dilution buffer Final concentrations 1. 1 : ul/23ul 300 pg/ul (A) 2. 1 : 10 5 ul/45ul 100 pg/ul (B) 3. A dilution 1:10 5ul(A)/45ul 30 pg/ul (C)

16 4. B dilution 1:10 5ul(B)/45ul 10 pg/ul (D) 5. C dilution 1:10 5ul(C)/45ul 3 pg/ul (E) 3 1ul A E DIG, ml buffer 2, 2 2ml, 3 2ml buffer 1, 4 2ml buffer 3, 5 2ml 5 DIG Vial 1 Vial 2 Vial 1 Vial 3 Vial 4 Vial 5 Blocking Antibody binding Blocking Washing Equilibration Color reaction ( in the dark) 2 min 3 min 1 min 1 min 1 min 5-30 min 6 1 NC ddw 3min 2 NC 20 SSC 15min 3 NC NC DNA NC 15 SSC NC 3 DNA ddw TE 1 5min 6 SSC 200ul 1min

17 Degree papers are in the Xiamen University Electronic Theses and Dissertations Database. Full texts are available in the following ways: 1. If your library is a CALIS member libraries, please log on and submit requests online, or consult the interlibrary loan department in your library. 2. For users of non-calis member libraries, please mail to etd@xmu.edu.cn for delivery details.

2

10384 -------- 9601008 UDC---------------------- 1999 1999 1999 ------------------------ ------------------------ 1 2 .4...4 7 14.14..18..22..22..24 3 4.27.32.39 1 2 3 4 5 6 7 8 9 10 11 5 12 6 1 2 3 4