untitled

Size: px

Start display at page:

Download "untitled"

曼乐
7 years ago
Views:

1 立理螺狀度 1.0~4.0 µm 1µm 1000 數易離不度數數類行 (presumptive diagnosis) 參行 (confirmatory diagnosis) 行離類見葉葉葉 leaf blight gall 見切見量切罹更罹離連理連行

2 Bacterial soft rot Erwinia carotovora subsp. carotovora Erwinia chrysanthemi 糧 Erwinia 離不良利力力泌量狀爛泥狀若葉裂 Erwinia 若葉量若行罹利 NA 行離落利 CVP 1 N NaOH, 4.5 ml; 10% CaCl 2 2H 2 O, 3.0 ml; NaNO 3, 1.0 g; Agar, 1.5 g; Sodium polypectate, 10.0 g; 0.075% crystal violet, 1.0 ml; DW, 500 ml 行理行利 5A 5 -GCGGTTGTTCACCAGGTGTTTT-3 5B 5 -ATGGCACGCTACCTGGAAGTAT-3 Y1 5 -TTACCGGACGCCGAGCTGTGGCGT-3 Y2 5 -CAGGAAGATGTCGTTATCGCGAGT Darrasse et al., 1994 PCR 罹行 5A/5B E. chrysanthemi 500 bp DNA Y1/Y2 E. carotovora subsp. carotovora 434 bp DNA Biolog 來 Erwinia Bacterial wilt Ralstonia solanacearum R. solanacearum Pseudomonas solancearum 蘭 30 不 (complex species) 類兩來異理 race 理 race 1 solanaceous strain 理 race 2 Heliconia moko disease musaceous strain 理 race 3 鈴鈴 potato strain 理 race 4 律離

3 ginger strain 理 race 5 陸離鈴 mulberry strain 類理 lactose, maltose cellobiose 六 mannitol, sorbitol ducitol 力 biovar 理聯見理數鈴蘿落利 comfrey 柳蓮葉若罹切見切見量流利行罹利 TTC casein hydrolysate, 1.0 g; Peptone, 10.0 g; Glucose, 5.0 g; Agar, 17.0 g; after autoclave add 1% 2,3,5-triphenytetrazolium chloride 行離 28 2~3 流不滑狀落利 SM-1 TTC medium after autoclaving add Merthiolate tincture 5~50 µl, Crystal violet 50 mg, Polymyxin β sulfate100 mg, Tyrothricin 20 mg, Chloromycetin 5 mg, Cycloheximide 50mg 行離行理利 GTCGCCGTCAACTCACTTTCC GTCGCCGTCAGCAATGCGGAATCG-3 Opina etal., 1997 連行罹 Biolog Burkholderia caryophylli Bacterial wilt caused by B. caryophylli Ralstonia solanacearum 辰 Burkholderia caryophylli B. caryophylli Pseudomonas caryophylli 蘭狀略 PDA 落滑不力 king s B 不 catalase oxidase 葉切 B. caryophylli 力不不易行罹

4 利 PDA 行離行行理 B. caryophylli 利 20L/21R PCR ELISA 來罹 B. caryophylli 鈴輪 Ring rot of Potato Clavibacter michiganensis subsp. sepedonicus 蘭狀葉葉葉輪狀爛狀爛切利 30 利 1982 行罹行離 growth factors biotin nicotinic acid thiamine Tryptose 行離落 20 落 8~10 mm 落狀狀滑落度 18~26 利 SP1f 5 -CCTTGTGGGGTGGGAAAA-3 SP1r 5 -TGTGATCCACCGGGTAAA-3 Li et al., 1995 行連行罹 Biolog C. michiganensis subsp. sepedonicus Black rot of crucifers Xanthomonas campestris pv. campestris 蘭 Xanthmonadin 落 Xanthan gum 落滑葉見葉 V 暈葉裂葉若量 damping off 葉狀量利行罹利 NA PDA 行離行離滑落利

5 SMA KH 2 PO 4, 1.0 g; Na 2 HPO 4, 2.6 g; NH 4 Cl, 1.0 g; NaCl, 2.0 g; MgSO 4 7H 2 O, 0.2 g; CaCl 2 2H 2 O, 67.0 mg; Glucose, 1.0 g; L-methionine, 0.2 g; Starch soluble potato, 10.0 g; Methyl violet 2B, 1.0 ml; Methyl green, 2.0 ml; Trace element solution, 1.0 ml; Triphenyltertrazolium chloride, 1.0 ml; Cycloheximide, 50.0 mg, Agar 20.0 g 行離行理行 Biolog X. campestris pv. campestris 葉 Bacterial blight of anthurium Xanthomonas axonopodis pv. dieffenbachiae 蘭 Xanthmonadin 落糖 Xanthan gum 落滑不異葉葉狀不葉葉葉狀葉葉葉葉易落落葉見泥 28~32 葉罹行行罹利 NA 行離行離 30 48~72 滑落利 Esulin-trehalose medium Esculin 1.0 g, Trehalose 0.5 g, FeCl 3 6H 2 O 0.5g, NaCl 5.0 g, MgSO 4 7H 2 O 0.2 g, K 2 HPO g, Agar 15.0 g, after autoclaving add Cycloheximide(1 g to 10 ml of 75% ethanol) 1.5 ml, Cephaxlexin(100 mg to 10 ml of 75% ethanol) 5 ml, Tirmethoprine 3.0 ml, Pyridoxine(1 mg/ml) 1.0 ml, D-methionine (1 mg/ml) 3.0 ml, Triphenyl-tetrazolium chloride(1% aquesous) 5.0 ml 行離離利葉來利 Dif1 5 -CCGGTATGCGAAAGTCCCATCA-3 Dir1 5 -GCGTATGGCCCCGAGGCAAC-3 林 1999 行連來罹葉 Biolog 利來葉 Bacterial spot of tomato and pepper Xanthomonas axonopodis pv. vesicatoria Xav X. vesicatoria Xv

6 兩類蘭 Xanthmonadin 落 Xanthan gum 落滑兩類利力異 Xav 不力 Xv 兩力兩 3~5 狀葉易落葉兩類葉葉葉度 25 ~ 32 度 20 不行罹利 NA 行離行離 30 48~72 滑落利 Tween medium Peptone 10.0 g, Potassium bromide 10.0 g, CaCl g, Agar 15.0 g, after autoclaving add Tween ml, Cycloheximide 75.0 mg, Cephalexin 25.0 mg, 5-Fluorouracil 6.0 mg, Tobramycin 0.4 mg 行離 Tween 80 沈行利 RST13 5 -TGGTTCCAGCCGTCCAGCAGGG-3 RST14 5 -CCCTAAAGGCACTGGGCGTCGG-3 C-2-2L 5 -CAGCAACACGCTGAAATCGTAG-3 C-2-2R 5 -TAGGGCGTCAGCTTGCAATG-3 行連罹利 X. axonopodis pv. vesicatoria X. vesicatoria 呂 2003 類 Bacterial blotch of cucurbits Acidovorax avenae subsp. citrulli Pseudomonas pseudoalcaligenes subsp. citrulli 了類類蘭 41 利糖 king s B (lipolytic activity) 葉 hypersensitivity reaction 不異葉葉狀易罹葉度葉肋狀不狀罹罹裂爛類葉度見泥葉

7 裂滑類不狀罹類不類罹葉罹狀度葉狀數罹罹泌泥臘罹爛留罹蘆行罹 king s B 行離落良 WFB68 (5g Bacto-peptone, 0.25g Calcium chloride dihydrate, 10ml Tween 80, 0.2g Berberine, g Methyl violet B, 15g Agar, 0.05g Carbenicillin, 0.05g Cefoperezone, 0.2g Cycloheximide, 1l H 2 O) 落落綠落葉離葉來行理 Biolog GN Microplate TM ( Biolog Inc. CA, USA) SL1/SR1 PCR 罹 1999 聯 Enzyme-linked immunosorbent assay ELISA 行類靈度 10 4 ~10 5 CFU/ml 若離連 Immunomagnetic separation and polymearse chain reaction IMS-PCR 靈度 2001 Bacterial blotch of carambola Pseudomonas syringae 葉落葉量 Pseudomonas syringae 蘭狀不度 Levan 不 Kovacs 鈴力不 Arginine dihydrolase (tobacco hypersensitive reaction) 不不 pathovar 不陸 Pseudomonas syringae pv. averrhoi 葉暈葉易

8 落稜落見年葉罹葉易行罹利 King s B 行離行行理行 S1 5 -CTAAAGTCATTCATCCACTCC-3 /R-S1 5 -GAAAATGAGACGCTGATCC 行 PCR 罹類 Bacterial canker of citrus Xanthomonas axonopodis pv. citri 類類年度北蘭 0.5~ ~2.0 µm NA 滑落度 25~30 X. axonopodis pv. citri 葉葉量落罹不糖 C 類降理類不略異葉狀綠裂狀老不不葉見暈 8 類葉暈暈更更罹利 NA 行離行離 30 48~72 滑落離利葉來行 Hartung 1993 年 2 5'-TGGTGTCGTCGCTTGTAT-3' 3 5'-CACGGGTGCAAAAAATC-3' Hartung et al., bp DNA

9 罹 monoclonal antibodies 行 Black spot of mango Xanthomonas campestris pv. mangiferaeindicae 葉落葉落蘭不落糖 Xanthan gum 落滑葉狀綠隆狀不葉不狀罹落狀隆狀裂罹易落泥利 1995 罹利 NA 行離行離 30 48~72 落 PDA 30 48~72 若落落行理 Crown gall of rose Agrobacterium tumefaciens 蘭狀 1~6 度 25~28 數葉數葉裸梨林力異 A. tumefaciens 不立 1997 易爛若見離行切 PDA 28 48~72 若見落利蘿行離 A. tumefaciens 利 VirD1F 5 -ATGTCGC AAGGCAGTAGGCCCACCT-3 VirD1R 5 -CTACAAGGCGTCTTTCAGCAGCGA GC-3 PCR Agrobacterium sp. 行

10 暈葉 halo blight of bean Pseudomonas syringae pv. phaseolicola 20 Gram King s B phaseolotoxin 葉暈若度 28 暈不 dark-sunken spots 不暈泥 bacterial ooze 度若 28 量降若量 Girdling of seedling stem 力行罹利 King s B 行離行行行理利 HM6 5 -CGTGTCCGTGGATAAAAGC-3 HM13 5 GTTGAATTTCACTACCCG-3 連行 Prosen et al., ELISA Kit ADGEW Scotland, UK Brown spot of bean Pseudomonas syringae pv. syringae Gram 20 葉暈類葉 P. syringae pv. syringae 易力行罹利 King s B 行離行行行理 Bacterial canker of tomato Clavibacter michiganensis subsp. michiganensis 蘭狀 16 ~ 28 暈見泥 2~3 年行罹利 CMS Sucrose 10.0g, Yeast extract 0.1 g, K 2 HPO g, KH 2 PO g, MgSO 4 7H 2 O 0.25 g, Boric acid

11 1.5 g, after autoclaving add nicotinic acid 100 mg, nalidixic acid 30 mg, potassium tellurite 10 mg, cycloheximide 200 mg 行離 Schaad et al., 2001 行理行 CMR16F1 5 -GTGATGTCAGAGCTTGCTCTGGCGGAT-3 CMR16R1 5 -GTACGGCTACCTTGTTACGACTTAGT-3 行連行利 Biolog 行梨 Fire blight of apple and pear Erwinia amylovora 138 梨梨蘭狀 YDC 落 hypersensitivity reaction 力梨葉 E. amylovora 度罹見泥 (Shepherd's crook) 葉葉葉葉罹狀狀罹梨量降罹數年易類行行利 NA nutrient Agar 落 CCT 100 g Sucrose, 10 g Sorbitol, 2 ml Crystal violet, 23 g Nutrient agar, 30 ml Tergitol anionic 7, 2 ml Thallium nitrate (1%w/v), 50 mg Cycloheximide, 1 l H 2 O Ishimaru and Klos E. amylovora 4-7mm 藍滑落見落藍離利來行理 Biolog GN Microplate TM Biolog Inc. CA., USA API 20E API 50 CH 行 Schaad et al., 2001 Bereswill 1992 年 A 5'-CGGTTTTTAACGCTGGG-3' B 5'-GGGCAAATACTCGGATT-3' E. amylovora 900 bp DNA 罹 ELISA 行 Lin et al.,

12 見略參參 Erwinia chrysanthemi 異藍 PCR 立理論 Burkholderia caryophylli 立理論類連立理論連立理論 5. 呂 2003 Xanthomonas vesicatoria 連立理論 6. 林 1999 葉 PCR 立理論立理論立理論葉立理論 10. 林 1997 Agrobacterium tumefeciens 39: 鈴輪立理論連 Burkholderia caryophylli 立理論 13. 玲 2000 PCR 立理論 14. Bereswill, S., Pahl, A., Bellemann, P., Zeller, W., and Geider, K Sensitive and species-specific detection of Erwinia amylovora by polymerase chain reaction analysis. Appl. Environ. Microbiol. 58: Darrasse A, Priou S, Kotoujansky A, Bertheau Y, PCR and restriction fragment-length-polymorphism of a pel gene as a tool to identify Erwinia carotovora in

13 relation to potato disease. Appl.,Environ. Microbiol. 60: Hartung, J. S., Daniel, J. F., and Pruvost, O.P Detection of Xanthomonas campestris pv. citri by polymerase chain reaction method. Appl. Env. Microbiol. 59: Ishimaru, C. and Klos, E. J New medium for detection of Erwinia amylovora and its use in epidemiological studies. Phytopatholgy 74: Li, Xiang and de Boer, S. H Selection of polymerase chain reaction primers from an RNA intergenic spacer region for specific detection of Clavibacter michiganensis subsp. sepedonicus. Phytopathology 85: Lin, C. P., Chen, T. A., Wells, J. M., and van der Zwet, T Identification and detection of Erwinia amylovora with monoclonal antibodies. Phytopathology 77: Opina, N., Tavner, F., Hollway, G., Wang, J. F., Li, T. H., Maghirang, R., Fegan, M., Hayward, A. C., Krishnapillai, V., Hong, W. F., Holloway, B. W., and Timmis, J. N A novel method for development of species and strain-specific DNA probe and PCR primers for identifying Burkholderia solanacearum (formerly Pseudomonas solanacearum). Asia-Pacific J. Molec. Biol. Biotechnology 5: Prosen, D., Hatziloukas, E., Schaad, N. W., and Panopoulos, N. J Specific detection of Pseudomonas syringae pv. phaseolicola DNA in bean seed by PCR-based amplification of a phaseolotoxin gene region. Phytopathology 83: Schaad N. W., Jones, J. B., and Chun, W Laboratory Guide for Identification of Plant Pathogenic Bacteria. 3 rd ed. APS press, The American Phytopathological Society. Minnesota, U.S.A. 373pp

14 A B C D E F Erwinia carotovora subsp. carotovora Erwinia chrysnathemi A. B. 鈴罹爛 C. 鈴鈴 D. 罹 E. 罹 F. Erwinia CVP 落

15 A B C C D Ralstonia solanacearum A. B. C. 蘿 D. 罹 E. 力 Ralstonia solanacearum E TTC 落 E

16 A B C D Burkholderia caryophylii A. 罹 B. 罹 C. 罹 D. 辰罹 E. Burkholderia caryophylii E PDA 落 E

17 A B A B C D D E Clavibacter michiganensis subsp. sepedonicus 鈴輪 A. 鈴輪罹 B. 鈴輪罹 C. 鈴 ( ) 輪罹 ( ) D. 罹鈴見輪 E. Clavibacter michiganensis subsp. sepedonicus 落 E

18 Xanthomonas campestris pv. campestris 藍葉 V

19 A B A B C C 六 (A) (B) 葉 PDA 落 (C)

20 A B C D E F 類類 A. B. 綠狀 C. D. 葉 E. 葉

21 A B C D Pseudomonas syringae A. 罹葉暈 B. 罹葉 C. 罹 D. 罹稜 D Agrobacterium tumefaciens 罹

認識[第2型]糖尿病

認識[第2型]糖尿病識糖尿療糖尿糖尿糖尿泌糖尿六糖尿糖尿療糖尿療糖尿療糖尿糖尿糖異糖度降不不良糖度糖尿來糖尿糖尿糖尿年糖尿狀糖糖糖糖糖尿類糖尿年來類糖尿糖尿糖尿異糖尿糖尿糖尿糖尿年糖糖尿數糖糖糖糖不良糖糖不良糖尿糖尿糖尿糖